Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD37 Recombinant Protein

Product Specifications

Background

Tetra-spans transmembrane family (TSTF) members (CD9, CD37, CD53, CD63, CD81 and CD82) are cell-surface proteins that are characterized by the presence of four hydrophobic, membrane-spanning domains. TSTF members can mediate signal transduction events influencing the regulation of cell development, adhesion, activation, growth and motility. The human CD37 gene maps to chromosome 19p13.3 and encodes a 281 amino acid protein. CD37 is a cell surface glycoprotein that can complex with integrins and other TSTF proteins and may play a role in T cell-B cell interactions. CD37 is strongly expressed on normal and neoplastic mature sIg+ B cells and is detected at low levels on resting and activated T cells, neutrophils, granulocytes and monocytes. Transgenic mouse models elicit no changes in development and cellular composition of lymphoid organs where CD37 is lacking.

CAS Number

9000-83-3

Swiss Prot

P11049

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~16kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CGTGCACAGCTGGAACGCAGTCTGCGCGATGTTGTTGAAAAAACCATTCAGAAATACGGTACCAATCCGGAAGAAACCGCAGCAGAAGAAAGCTGGGATTATGTTCAGTTCCAGCTGCGTTGTTGCGGTTGGCATTATCCGCAGGATTGGTTCCAGGTTCTGATTCTGCGCGGTAATGGTAGCGAAGCACATCGTGTTCCGTGCAGTTGTTATAATCTGAGTGCCACCAATGATAGTACCATTCTGGATAAAGTGATTCTGCCGCAGCTGAGCCGTCTGGGCCATCTGGCACGTAGTCGCCATAGCGCAGATATCTGTGCAGTGCCGGCCGAAAGTCATATCTATCGCGAAGGCTGTGCACAGGGCCTGCAGAAATGGCTGCATAATAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Hsa-miR-299-5p miRNA Mimic
CMH0315-01 5 nmol

Hsa-miR-299-5p miRNA Mimic

Sign In for Pricing
View Details
Hsa-miR-299-5p miRNA Mimic
CMH0315-02 10 nmol

Hsa-miR-299-5p miRNA Mimic

Sign In for Pricing
View Details
2,4-Dinitrophenyl 3,4-di-O-acetyl-2-deoxy-2-fluoro-α-D-lyxopyranoside
GC9571-50mg 50 mg

2,4-Dinitrophenyl 3,4-di-O-acetyl-2-deoxy-2-fluoro-α-D-lyxopyranoside

Sign In for Pricing
View Details
Cass4 (NM_001080820) Mouse Tagged Lenti ORF Clone
MR219833L3 10 µg

Cass4 (NM_001080820) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Mouse Monoclonal Cytokeratin 15 Antibody (KRT15/2957) [mFluor Violet 450 SE]
NBP3-08478MFV450 0.1 mL

Mouse Monoclonal Cytokeratin 15 Antibody (KRT15/2957) [mFluor Violet 450 SE]

Sign In for Pricing
View Details
Kifbp Rat shRNA Plasmid (Locus ID 606294)
TR703137 1 Kit

Kifbp Rat shRNA Plasmid (Locus ID 606294)

Sign In for Pricing
View Details