Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD34 Recombinant Protein

Product Specifications

Background

CD34 is a type I transmembrane glycophosphoprotein expressed by hematopoietic stem/progenitor cells, vascular endothelium and some fibroblasts . CD34 expression has been the hallmark used to identify hematopoietic stem cells for many years. CD34+ hematopoietic stem cells expand and differentiate into all the lymphohematopoietic lineages upon cytokine or growth factor stimulation and lose CD34 expression upon differentiation. However, recent studies performed in various laboratories conflict with that convention. The extracellular domain of CD34 is homologous to CD43, a protein involved in cell-cell adhesion, and CD34 has been shown to function as a negative regulator of cell adhesion. CD34 associates with CrkL but not CrkII, is a substrate for PKC, and activation of PKC is coupled with surface expression of CD34.

CAS Number

9000-83-3

Swiss Prot

P28906

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~34kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGTCTGGATAATAACGGCACCGCAACCCCGGAACTGCCGACCCAGGGCACCTTCAGCAATGTTAGCACCAATGTTAGCTATCAGGAAACCACCACCCCGAGCACCCTGGGCAGCACCAGCCTGCATCCGGTTAGCCAGCATGGTAATGAAGCAACCACCAATATTACCGAAACCACCGTTAAATTCACCAGCACCAGTGTTATTACCAGCGTGTATGGTAATACCAATAGCAGTGTGCAGAGTCAGACCAGCGTTATTAGTACCGTGTTCACCACCCCGGCAAATGTTAGCACACCGGAAACCACCCTGAAACCGAGTCTGAGTCCGGGCAATGTGAGTGATCTGAGTACCACCAGTACCAGTCTGGCAACCAGCCCGACCAAACCGTATACCAGTAGCAGCCCGATTCTGAGTGATATTAAAGCCGAAATTAAGTGTAGCGGCATTCGTGAAGTTAAACTGACCCAGGGTATCTGTCTGGAACAGAATAAAACCAGCAGCTGCGCCGAATTCAAAAAAGATCGCGGTGAAGGTCTGGCCCGCGTGCTGTGCGGCGAAGAACAGGCAGATGCAGATGCAGGTGCCCAGGTGTGTAGCCTGCTGCTGGCACAGAGTGAAGTTCGTCCGCAGTGCCTGCTGCTGGTGCTGGCAAATCGTACCGAAATTAGTAGCAAACTGCAGCTGATGAAAAAACATCAGAGCGATCTGAAAAAACTGGGCATTCTGGACTTCACCGAACAGGATGTGGCAAGTCATCAGAGTTATAGCCAGAAAACC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

C11orf49 cDNA Clone
MBS1273695-01 0.01 mg Plasmid + 0.2 mL Glycerol-Stock

C11orf49 cDNA Clone

Sign In for Pricing
View Details
C11orf49 cDNA Clone
MBS1273695-02 5x 0.01 mg Plasmid + 5x 0.2 mL Glycerol-Stock

C11orf49 cDNA Clone

Sign In for Pricing
View Details
Mouse Transmembrane protein 87A, TMEM87A ELISA Kit
MBS9331235-01 48 Well

Mouse Transmembrane protein 87A, TMEM87A ELISA Kit

Sign In for Pricing
View Details
Mouse Transmembrane protein 87A, TMEM87A ELISA Kit
MBS9331235-02 96 Well

Mouse Transmembrane protein 87A, TMEM87A ELISA Kit

Sign In for Pricing
View Details
Mouse Transmembrane protein 87A, TMEM87A ELISA Kit
MBS9331235-03 5x 96 Well

Mouse Transmembrane protein 87A, TMEM87A ELISA Kit

Sign In for Pricing
View Details
Mouse Transmembrane protein 87A, TMEM87A ELISA Kit
MBS9331235-04 10x 96 Well

Mouse Transmembrane protein 87A, TMEM87A ELISA Kit

Sign In for Pricing
View Details