Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD320 Recombinant Protein

Product Specifications

Background

The 8D6 protein, also known as 8D6A, CD320 or FDC-SM-8D6, is a single pass, type I membrane protein with two low-density lipoprotein receptor ligand binding repeats (LDL-A modules) . It is expressed by follicular dendritic cells in the germinal center and acts as a stimulatory signaling molecule. Follicular dendritic cells and T cells interact with germinal center B cells, providing signals for survival, proliferation and differentiation into memory B cells and plasma cells. A disruption of this interaction results in apoptosis of B cells. 8D6 is a growth factor required for plasma cell generation from germinal center B cells. Protein 8D6, together with HCAM (or CD44), plays a significant role in the proliferation of lymphoma cells of germinal center origin. 8D6 is responsible for enhancing proliferation while HCAM inhibits apoptosis.

CAS Number

9000-83-3

Swiss Prot

Q9NPF0

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~27kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Human/Mouse/Rat GIT1 Alexa Fluor 488 Antibody
IC8508G-100UG 100 µg

Human/Mouse/Rat GIT1 Alexa Fluor 488 Antibody

Ask
View Details
BCAR1, 465-848aa, Human, His tag, E.coli
E53A01301 50 µg

BCAR1, 465-848aa, Human, His tag, E.coli

Ask
View Details
CITED1 (NM_001144887) Human Tagged ORF Clone
RG227383 10 µg

CITED1 (NM_001144887) Human Tagged ORF Clone

Ask
View Details
Recombinant Rat Electron transfer flavoprotein subunit beta (Etfb)
MBS1298743-01 0.02 mg (E-Coli)

Recombinant Rat Electron transfer flavoprotein subunit beta (Etfb)

Ask
View Details
Recombinant Rat Electron transfer flavoprotein subunit beta (Etfb)
MBS1298743-02 0.1 mg (E-Coli)

Recombinant Rat Electron transfer flavoprotein subunit beta (Etfb)

Ask
View Details
Recombinant Rat Electron transfer flavoprotein subunit beta (Etfb)
MBS1298743-03 0.02 mg (Yeast)

Recombinant Rat Electron transfer flavoprotein subunit beta (Etfb)

Ask
View Details