Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD320 Recombinant Protein

Product Specifications

Background

The 8D6 protein, also known as 8D6A, CD320 or FDC-SM-8D6, is a single pass, type I membrane protein with two low-density lipoprotein receptor ligand binding repeats (LDL-A modules) . It is expressed by follicular dendritic cells in the germinal center and acts as a stimulatory signaling molecule. Follicular dendritic cells and T cells interact with germinal center B cells, providing signals for survival, proliferation and differentiation into memory B cells and plasma cells. A disruption of this interaction results in apoptosis of B cells. 8D6 is a growth factor required for plasma cell generation from germinal center B cells. Protein 8D6, together with HCAM (or CD44), plays a significant role in the proliferation of lymphoma cells of germinal center origin. 8D6 is responsible for enhancing proliferation while HCAM inhibits apoptosis.

CAS Number

9000-83-3

Swiss Prot

Q9NPF0

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~27kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Oxyntomodulin (Human, Rat, Mouse) - Antibody
H-028-22 100 µL

Oxyntomodulin (Human, Rat, Mouse) - Antibody

Sign In for Pricing
View Details
UBE2Q1 Polyclonal Antibody
orb1089225-01 100 µL

UBE2Q1 Polyclonal Antibody

Sign In for Pricing
View Details
UBE2Q1 Polyclonal Antibody
orb1089225-02 200 µL

UBE2Q1 Polyclonal Antibody

Sign In for Pricing
View Details
Recombinant other Gliadin Gamma Wheat Protein, His, E.coli-100ug
QP11985-100ug 100ug

Recombinant other Gliadin Gamma Wheat Protein, His, E.coli-100ug

Sign In for Pricing
View Details
PET117 (NM_001164811) Human Tagged Lenti ORF Clone
RC228028L3 10 µg

PET117 (NM_001164811) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Human Zinc Finger Protein 223 (ZNF223) ELISA Kit
abx554509 96 Tests

Human Zinc Finger Protein 223 (ZNF223) ELISA Kit

Sign In for Pricing
View Details