Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD320 Recombinant Protein

Product Specifications

Background

The 8D6 protein, also known as 8D6A, CD320 or FDC-SM-8D6, is a single pass, type I membrane protein with two low-density lipoprotein receptor ligand binding repeats (LDL-A modules) . It is expressed by follicular dendritic cells in the germinal center and acts as a stimulatory signaling molecule. Follicular dendritic cells and T cells interact with germinal center B cells, providing signals for survival, proliferation and differentiation into memory B cells and plasma cells. A disruption of this interaction results in apoptosis of B cells. 8D6 is a growth factor required for plasma cell generation from germinal center B cells. Protein 8D6, together with HCAM (or CD44), plays a significant role in the proliferation of lymphoma cells of germinal center origin. 8D6 is responsible for enhancing proliferation while HCAM inhibits apoptosis.

CAS Number

9000-83-3

Swiss Prot

Q9NPF0

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~27kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

GNRH2 Protein Lysate
OCOA14576-20UG 20 µg

GNRH2 Protein Lysate

Sign In for Pricing
View Details
EIF4A1P3 ORF Vector (Human) (pORF)
ORF018815 1.0 µg DNA

EIF4A1P3 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details
Canine permeability glycoprotein (P-gp) ELISA Kit
NSL1606Ca 96 Tests

Canine permeability glycoprotein (P-gp) ELISA Kit

Sign In for Pricing
View Details
PRRT2 Polyclonal Antibody
29541-01 50 µL

PRRT2 Polyclonal Antibody

Sign In for Pricing
View Details
PRRT2 Polyclonal Antibody
29541-02 100 µL

PRRT2 Polyclonal Antibody

Sign In for Pricing
View Details
MAP2, CT (Microtubule Associated Protein 2, MAP-2) (MaxLight 405)
MBS6486467-01 0.1 mL

MAP2, CT (Microtubule Associated Protein 2, MAP-2) (MaxLight 405)

Sign In for Pricing
View Details