CD32 (FcgammaRIIb) Recombinant Protein
Product Specifications
Background
FcγRIIB (CD32B) is a low affinity, IgG Fc-binding receptor expressed on B cells, monocytes, macrophages, and dendritic cells (DCs) . It is the inhibitory Fc receptor and signals through an immunoreceptor tyrosine-based inhibitory motif (ITIM) within its carboxy-terminal cytoplasmic tail. Binding of immune complexes to FcγRIIB results in tyrosine phosphorylation of the ITIM motif at Tyr292 and recruitment of the phosphatase SHIP, which mediates inhibitory effects on immune cell activation. In this way, FcγRIIB suppresses the effects of activating Fc-binding receptors. For example, mice deficient for FcγRIIB have greater T cell and DC responses following injection of immune complexes . In addition, FcγRIIB plays a role in B cell affinity maturation. Signaling through FcγRIIB in the absence of signaling through the B cell receptor (BCR) is proapoptotic, while signaling through FcγRIIB and the BCR simultaneously attenuates the apoptotic signal and results in selection of B cells with higher antigen affinity.
CAS Number
9000-83-3
Swiss Prot
P31994
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~23kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
ACCCCTGCTGCACCGCCTAAAGCAGTGCTGAAACTGGAACCGCAGTGGATTAATGTTCTGCAGGAAGATAGTGTGACCCTGACCTGCCGCGGCACCCATAGTCCGGAAAGTGATAGTATTCAGTGGTTCCATAATGGCAATCTGATTCCGACCCATACCCAGCCGAGTTATCGCTTCAAAGCCAATAATAATGATAGTGGCGAATATACCTGCCAGACCGGTCAGACCAGCCTGAGCGATCCGGTGCATCTGACCGTTCTGAGCGAATGGCTGGTTCTGCAGACCCCGCATCTGGAATTCCAGGAAGGTGAAACCATTGTGCTGCGCTGTCATAGCTGGAAAGATAAACCGCTGGTTAAAGTTACCTTCTTCCAGAATGGTAAAAGTAAAAAATTCAGCCGCAGCGATCCGAACTTCAGCATTCCGCAGGCCAATCATAGTCATAGCGGCGATTATCATTGCACCGGTAATATTGGTTATACCCTGTATAGCAGTAAACCGGTGACCATTACCGTGCAGGCCCCG
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items