Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD32 (FcgammaRIIb) Recombinant Protein

Product Specifications

Background

FcγRIIB (CD32B) is a low affinity, IgG Fc-binding receptor expressed on B cells, monocytes, macrophages, and dendritic cells (DCs) . It is the inhibitory Fc receptor and signals through an immunoreceptor tyrosine-based inhibitory motif (ITIM) within its carboxy-terminal cytoplasmic tail. Binding of immune complexes to FcγRIIB results in tyrosine phosphorylation of the ITIM motif at Tyr292 and recruitment of the phosphatase SHIP, which mediates inhibitory effects on immune cell activation. In this way, FcγRIIB suppresses the effects of activating Fc-binding receptors. For example, mice deficient for FcγRIIB have greater T cell and DC responses following injection of immune complexes . In addition, FcγRIIB plays a role in B cell affinity maturation. Signaling through FcγRIIB in the absence of signaling through the B cell receptor (BCR) is proapoptotic, while signaling through FcγRIIB and the BCR simultaneously attenuates the apoptotic signal and results in selection of B cells with higher antigen affinity.

CAS Number

9000-83-3

Swiss Prot

P31994

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~23kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

ACCCCTGCTGCACCGCCTAAAGCAGTGCTGAAACTGGAACCGCAGTGGATTAATGTTCTGCAGGAAGATAGTGTGACCCTGACCTGCCGCGGCACCCATAGTCCGGAAAGTGATAGTATTCAGTGGTTCCATAATGGCAATCTGATTCCGACCCATACCCAGCCGAGTTATCGCTTCAAAGCCAATAATAATGATAGTGGCGAATATACCTGCCAGACCGGTCAGACCAGCCTGAGCGATCCGGTGCATCTGACCGTTCTGAGCGAATGGCTGGTTCTGCAGACCCCGCATCTGGAATTCCAGGAAGGTGAAACCATTGTGCTGCGCTGTCATAGCTGGAAAGATAAACCGCTGGTTAAAGTTACCTTCTTCCAGAATGGTAAAAGTAAAAAATTCAGCCGCAGCGATCCGAACTTCAGCATTCCGCAGGCCAATCATAGTCATAGCGGCGATTATCATTGCACCGGTAATATTGGTTATACCCTGTATAGCAGTAAACCGGTGACCATTACCGTGCAGGCCCCG

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

TSC2 (S1387) (Tuberin, Tuberous Sclerosis 2 Protein, TSC4) (AP)
MBS6503984-01 0.2 mL

TSC2 (S1387) (Tuberin, Tuberous Sclerosis 2 Protein, TSC4) (AP)

Ask
View Details
TSC2 (S1387) (Tuberin, Tuberous Sclerosis 2 Protein, TSC4) (AP)
MBS6503984-02 5x 0.2 mL

TSC2 (S1387) (Tuberin, Tuberous Sclerosis 2 Protein, TSC4) (AP)

Ask
View Details
Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit
MBS7218144-01 48 Well

Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit

Ask
View Details
Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit
MBS7218144-02 96 Well

Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit

Ask
View Details
Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit
MBS7218144-03 5x 96 Well

Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit

Ask
View Details
Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit
MBS7218144-04 10x 96 Well

Rat Tyrosine-protein kinase Lck (LCK) ELISA Kit

Ask
View Details