Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD302 Recombinant Protein

Product Specifications

Background

CD302, potential multifunctional C-type lectin receptor that may play roles in endocytosis and phagocytosis as well as in cell adhesion and migration.

CAS Number

9000-83-3

Swiss Prot

Q8IX05

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~17kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GATTGCCCGAGTAGTACCTGGATTCAGTTCCAGGATAGCTGTTATATCTTCCTGCAGGAAGCCATTAAAGTTGAAAGCATTGAAGATGTGCGTAATCAGTGCACCGATCATGGCGCCGATATGATTAGTATTCATAATGAAGAAGAGAACGCATTCATTCTGGATACCCTGAAAAAACAGTGGAAAGGTCCGGATGATATTCTGCTGGGTATGTTCTATGATACCGATGATGCCAGCTTCAAATGGTTCGATAATAGTAATATGACCTTCGATAAGTGGACCGATCAGGATGATGATGAAGATCTGGTGGATACCTGCGCATTCCTGCATATTAAAACCGGCGAATGGAAAAAAGGTAATTGCGAAGTTAGTAGCGTGGAAGGTACCCTGTGTAAAACCGCAATTCCGTATAAACGCAAATATCTGAGCGATAATCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

SPTLC1 Rabbit Polyclonal Antibody
orb334627 100 µg

SPTLC1 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
ZC3H15 antibody
70R-8951 100 µL

ZC3H15 antibody

Sign In for Pricing
View Details
BCL6 Rabbit Polyclonal Antibody (Biotin)
orb2570398 100 µg

BCL6 Rabbit Polyclonal Antibody (Biotin)

Sign In for Pricing
View Details
Active Hepatocyte Growth Factor (HGF)
MBS2122260-01 0.01 mg

Active Hepatocyte Growth Factor (HGF)

Sign In for Pricing
View Details
Active Hepatocyte Growth Factor (HGF)
MBS2122260-02 0.05 mg

Active Hepatocyte Growth Factor (HGF)

Sign In for Pricing
View Details
Active Hepatocyte Growth Factor (HGF)
MBS2122260-03 0.1 mg

Active Hepatocyte Growth Factor (HGF)

Sign In for Pricing
View Details