Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD27 Recombinant Protein

Product Specifications

Background

CD27 (TNFRSF7) is a transmemebrane protein of the TNF receptor superfamily (TNFRSF) . It is mainly expressed on lymphoid cells (also on early hematopoietic precursor cells in mice) . CD27 is considered a phenotypic marker for memory B cells and is also used to identify B regulatory (Breg) cells. It is constitutively expressed on naïve CD4 and CD8 T cells and its expression is further upregulated upon T cell activation. CD27 is one of the two most important co-stimulatory receptors for T cell priming (the other one is CD28) . While CD28 co-stimulatory signal mainly triggers cell proliferation, CD27 co-stimulatory signal primarily promotes cell survival and differentiation. Upon binding to its ligand CD70, CD27 activates the NF-κB and JNK signaling pathways through TNFR associated factors (TRAFs), the adaptor molecules that are associated with CD27 cytoplasmic tail domain. Upon activation CD27 is shed from cell surface and soluble CD27 is used as a marker of T cell activation.

CAS Number

9000-83-3

Swiss Prot

P26842

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~22kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTACCCCTGCACCGAAAAGCTGCCCGGAACGTCATTATTGGGCCCAGGGCAAACTGTGCTGTCAGATGTGCGAACCGGGTACCTTCCTGGTGAAAGATTGTGATCAGCATCGCAAAGCAGCCCAGTGCGATCCGTGTATTCCGGGTGTTAGCTTCAGCCCGGATCATCATACCCGCCCGCATTGCGAAAGTTGTCGCCATTGTAATAGCGGTCTGCTGGTTCGTAATTGCACCATTACCGCAAATGCAGAATGTGCATGTCGCAATGGCTGGCAGTGTCGTGATAAAGAATGCACCGAATGCGATCCGCTGCCGAATCCGAGTCTGACCGCCCGTAGCAGCCAGGCACTGAGTCCGCATCCGCAGCCGACCCATCTGCCGTATGTTAGCGAAATGCTGGAAGCACGCACCGCCGGTCACATGCAGACCCTGGCCGACTTCCGCCAGCTGCCGGCACGTACCCTGAGCACCCATTGGCCGCCGCAGCGTAGTCTGTGCAGTAGTGACTTCATTCGC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral mouse Bbs5 shRNA (UAS) - Lentiviral mouse Bbs5 shRNA (UAS) (25)
GTR15155417 1 Vial

Lentiviral mouse Bbs5 shRNA (UAS) - Lentiviral mouse Bbs5 shRNA (UAS) (25)

Sign In for Pricing
View Details
Spryd4 (NM_001037765) Rat Tagged ORF Clone Lentiviral Particle
RR201479L4V 200 µL

Spryd4 (NM_001037765) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
TNFRSF25 Monoclonal Antibody
E10-31965P 100 µg -100 µL

TNFRSF25 Monoclonal Antibody

Sign In for Pricing
View Details
Innovative Grade US Origin Goat Plasma K2 EDTA 1000ml
IGGTPLAK2E1000ML 1000 mL

Innovative Grade US Origin Goat Plasma K2 EDTA 1000ml

Sign In for Pricing
View Details
Lentiviral human ARHGAP35 shRNA (UAS) - Lentiviral human ARHGAP35 shRNA (UAS) (25)
GTR15111857 1 Vial

Lentiviral human ARHGAP35 shRNA (UAS) - Lentiviral human ARHGAP35 shRNA (UAS) (25)

Sign In for Pricing
View Details
pLV3×HA-CopGFP-Puro Plasmid
PVT54343 2 µg

pLV3×HA-CopGFP-Puro Plasmid

Sign In for Pricing
View Details