Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD27 Recombinant Protein

Product Specifications

Background

CD27 (TNFRSF7) is a transmemebrane protein of the TNF receptor superfamily (TNFRSF) . It is mainly expressed on lymphoid cells (also on early hematopoietic precursor cells in mice) . CD27 is considered a phenotypic marker for memory B cells and is also used to identify B regulatory (Breg) cells. It is constitutively expressed on naïve CD4 and CD8 T cells and its expression is further upregulated upon T cell activation. CD27 is one of the two most important co-stimulatory receptors for T cell priming (the other one is CD28) . While CD28 co-stimulatory signal mainly triggers cell proliferation, CD27 co-stimulatory signal primarily promotes cell survival and differentiation. Upon binding to its ligand CD70, CD27 activates the NF-κB and JNK signaling pathways through TNFR associated factors (TRAFs), the adaptor molecules that are associated with CD27 cytoplasmic tail domain. Upon activation CD27 is shed from cell surface and soluble CD27 is used as a marker of T cell activation.

CAS Number

9000-83-3

Swiss Prot

P26842

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~22kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTACCCCTGCACCGAAAAGCTGCCCGGAACGTCATTATTGGGCCCAGGGCAAACTGTGCTGTCAGATGTGCGAACCGGGTACCTTCCTGGTGAAAGATTGTGATCAGCATCGCAAAGCAGCCCAGTGCGATCCGTGTATTCCGGGTGTTAGCTTCAGCCCGGATCATCATACCCGCCCGCATTGCGAAAGTTGTCGCCATTGTAATAGCGGTCTGCTGGTTCGTAATTGCACCATTACCGCAAATGCAGAATGTGCATGTCGCAATGGCTGGCAGTGTCGTGATAAAGAATGCACCGAATGCGATCCGCTGCCGAATCCGAGTCTGACCGCCCGTAGCAGCCAGGCACTGAGTCCGCATCCGCAGCCGACCCATCTGCCGTATGTTAGCGAAATGCTGGAAGCACGCACCGCCGGTCACATGCAGACCCTGGCCGACTTCCGCCAGCTGCCGGCACGTACCCTGAGCACCCATTGGCCGCCGCAGCGTAGTCTGTGCAGTAGTGACTTCATTCGC

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

RAMP3 CRISPR Activation Plasmid (h2)
sc-402235-ACT-2 20 µg

RAMP3 CRISPR Activation Plasmid (h2)

Ask
View Details
BEX4 (NM_001080425) Human Mass Spec Standard
PH313659 10 µg

BEX4 (NM_001080425) Human Mass Spec Standard

Ask
View Details
Human ACY1 (aminoacylase-1) ELISA Kit
EH4311 96 Tests

Human ACY1 (aminoacylase-1) ELISA Kit

Ask
View Details
Goat anti Rabbit IgG (Texas Red)
MBS538606-01 2 mg

Goat anti Rabbit IgG (Texas Red)

Ask
View Details
Goat anti Rabbit IgG (Texas Red)
MBS538606-02 5x 2 mg

Goat anti Rabbit IgG (Texas Red)

Ask
View Details
Recombinant Human Zinc Finger and BTB Domain-Containing Protein 9/ZBTB9 (C-6His)
32-8320-50 50 µg

Recombinant Human Zinc Finger and BTB Domain-Containing Protein 9/ZBTB9 (C-6His)

Ask
View Details