Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD27 Recombinant Protein

Product Specifications

Background

CD27 (TNFRSF7) is a transmemebrane protein of the TNF receptor superfamily (TNFRSF) . It is mainly expressed on lymphoid cells (also on early hematopoietic precursor cells in mice) . CD27 is considered a phenotypic marker for memory B cells and is also used to identify B regulatory (Breg) cells. It is constitutively expressed on naïve CD4 and CD8 T cells and its expression is further upregulated upon T cell activation. CD27 is one of the two most important co-stimulatory receptors for T cell priming (the other one is CD28) . While CD28 co-stimulatory signal mainly triggers cell proliferation, CD27 co-stimulatory signal primarily promotes cell survival and differentiation. Upon binding to its ligand CD70, CD27 activates the NF-κB and JNK signaling pathways through TNFR associated factors (TRAFs), the adaptor molecules that are associated with CD27 cytoplasmic tail domain. Upon activation CD27 is shed from cell surface and soluble CD27 is used as a marker of T cell activation.

CAS Number

9000-83-3

Swiss Prot

P26842

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~22kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTACCCCTGCACCGAAAAGCTGCCCGGAACGTCATTATTGGGCCCAGGGCAAACTGTGCTGTCAGATGTGCGAACCGGGTACCTTCCTGGTGAAAGATTGTGATCAGCATCGCAAAGCAGCCCAGTGCGATCCGTGTATTCCGGGTGTTAGCTTCAGCCCGGATCATCATACCCGCCCGCATTGCGAAAGTTGTCGCCATTGTAATAGCGGTCTGCTGGTTCGTAATTGCACCATTACCGCAAATGCAGAATGTGCATGTCGCAATGGCTGGCAGTGTCGTGATAAAGAATGCACCGAATGCGATCCGCTGCCGAATCCGAGTCTGACCGCCCGTAGCAGCCAGGCACTGAGTCCGCATCCGCAGCCGACCCATCTGCCGTATGTTAGCGAAATGCTGGAAGCACGCACCGCCGGTCACATGCAGACCCTGGCCGACTTCCGCCAGCTGCCGGCACGTACCCTGAGCACCCATTGGCCGCCGCAGCGTAGTCTGTGCAGTAGTGACTTCATTCGC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

WDR59 shRNA Plasmid (h)
sc-93290-SH 20 µg

WDR59 shRNA Plasmid (h)

Sign In for Pricing
View Details
Mouse Monoclonal DAX1/NR0B1 Antibody (OTI5F5) [PE]
NBP2-70116PE 0.1 mL

Mouse Monoclonal DAX1/NR0B1 Antibody (OTI5F5) [PE]

Sign In for Pricing
View Details
CD45 (HI30) Mouse Monoclonal Antibody (FITC Conjugate)
CST 86532S 500 µL

CD45 (HI30) Mouse Monoclonal Antibody (FITC Conjugate)

Sign In for Pricing
View Details
NOX5 Rabbit Polyclonal Antibody
E10G08572 100 µL

NOX5 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Lentiviral human HOXB13 shRNA (UAS) - Lentiviral human HOXB13 shRNA (UAS, RFP) plasmid
GTR15307540 1 Vial

Lentiviral human HOXB13 shRNA (UAS) - Lentiviral human HOXB13 shRNA (UAS, RFP) plasmid

Sign In for Pricing
View Details
DPM2 Protein Vector (Human) (pPM-C-His)
PV013016 500 ng

DPM2 Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details