Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD244 Recombinant Protein

Product Specifications

Background

2B4, also known as signaling lymphocytic activation molecule family member 4 (SLAMF4) and cluster of differentiation 244 (CD244), is a heterophilic cell surface receptor expressed on a variety of immune cells, including natural killer (NK) cells, T cells, eosinophils, mast cells, and dendritic cells. 2B4 has been shown to have both immune stimulatory and inhibitory effects on cells. Upon engagement of its ligand CD48, 2B4 can enhance immune cell signaling, cytokine production, non-major histocompatibility complex-restricted cytotoxicity, and cell migration. Conversely, at early stages of NK cell differentiation, 2B4 may function as an inhibitory receptor possibly ensuring the self-tolerance of developing NK cells. 2B4 also inhibits inflammatory responses in dendritic cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

CAS Number

9000-83-3

Swiss Prot

Q9BZW8

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

TGCCAGGGTAGCGCCGATCATGTGGTGAGTATTAGTGGTGTGCCGCTGCAGCTGCAGCCGAATAGCATTCAGACCAAAGTTGATAGTATTGCATGGAAAAAACTGCTGCCGAGCCAGAATGGCTTCCATCATATTCTGAAATGGGAAAATGGTAGCCTGCCGAGTAATACCAGTAATGATCGCTTCAGCTTCATTGTTAAAAATCTGAGTCTGCTGATTAAGGCCGCCCAGCAGCAGGATAGTGGCCTGTATTGCCTGGAAGTTACCAGTATTAGCGGTAAAGTTCAGACCGCAACCTTCCAGGTGTTCGTGTTCGAAAGCCTGCTGCCGGATAAAGTGGAAAAACCGCGCCTGCAGGGCCAGGGTAAAATTCTGGATCGTGGCCGTTGCCAGGTGGCCCTGAGTTGCCTGGTTAGCCGTGATGGCAATGTTAGTTATGCATGGTATCGCGGTAGCAAACTGATTCAGACCGCAGGCAATCTGACCTATCTGGATGAAGAAGTTGATATTAATGGCACCCATACCTATACCTGCAATGTGAGTAATCCGGTGAGTTGGGAAAGTCATACCCTGAATCTGACCCAGGATTGTCAGAATGCACATCAGGAATTCCGCTTCTGGCCG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MAPKAPK5 AAV Vector (Rat) (CMV)
28080107 1 µg

MAPKAPK5 AAV Vector (Rat) (CMV)

Sign In for Pricing
View Details
L-type Ca++ CP γ7 Lentiviral Activation Particles (m)
sc-429884-LAC 200 µL

L-type Ca++ CP γ7 Lentiviral Activation Particles (m)

Sign In for Pricing
View Details
ECHS1 Polyclonal Antibody, AbBy Fluor™ 594 Conjugated
bs-5058R-BF594 100 µL

ECHS1 Polyclonal Antibody, AbBy Fluor™ 594 Conjugated

Sign In for Pricing
View Details
KIAA1305 CRISPR All-in-one AAV vector set (with saCas9)(Human)
25601151 3x 1.0 µg DNA

KIAA1305 CRISPR All-in-one AAV vector set (with saCas9)(Human)

Sign In for Pricing
View Details
OLFML1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1481502 1.0 µg DNA

OLFML1 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Human ALDH3A1 Knockout A549 cell line
GTR15409975 1 Vial

Human ALDH3A1 Knockout A549 cell line

Sign In for Pricing
View Details