Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD226/DNAM-1 Recombinant Protein

Product Specifications

Background

DNAM-1/CD226 is a member of the immunoglobulin-like superfamily. It is expressed on T cells, natural killer (NK) cells, monocytes, and macrophages. It is a major activating receptor on NK cells. Engagement with its ligands Nectin-2 (CD112) and PVR (poliovirus receptor, also known as CD155) on the target cells leads to downstream activation of ERK, AKT, and PLCg2 signaling pathways that are crucial for NK activation and NK-mediated killing. LFA-1 physically associates with DNAM-1/CD226 and contributes to its signaling. Activating signal of DNAM-1/CD226 is counterbalanced by inhibitory receptors TIGIT and CD96, competing for the common ligands CD122 and PVR.

CAS Number

9000-83-3

Swiss Prot

Q15762

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~26kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAGAAGTTCTGTGGCATACCAGTGTTCCGTTCGCAGAAAATATGAGTCTGGAATGCGTGTATCCGAGTATGGGTATTCTGACCCAGGTGGAATGGTTCAAAATTGGTACCCAGCAGGATAGCATTGCAATCTTCAGTCCGACCCATGGTATGGTGATTCGCAAACCGTATGCAGAACGTGTGTACTTCCTGAATAGCACCATGGCCAGCAATAATATGACCCTGTTCTTCCGCAATGCCAGTGAAGATGATGTTGGCTATTATAGCTGTAGCCTGTATACCTATCCGCAGGGCACCTGGCAGAAAGTGATTCAGGTGGTTCAGAGTGATAGCTTCGAAGCAGCAGTTCCGAGCAATAGCCATATTGTGAGCGAACCGGGTAAAAATGTGACCCTGACCTGTCAGCCGCAGATGACCTGGCCGGTGCAGGCAGTTCGCTGGGAAAAAATTCAGCCGCGCCAGATTGATCTGCTGACCTATTGCAATCTGGTGCATGGCCGTAACTTCACCAGTAAATTCCCGCGTCAGATTGTGAGTAATTGTAGTCATGGCCGTTGGAGCGTTATTGTGATTCCGGATGTGACCGTTAGCGATAGTGGCCTGTATCGCTGTTATCTGCAGGCAAGCGCAGGCGAAAATGAAACCTTCGTGATGCGCCTGACCGTTGCAGAAGGTAAAACCGATAATCAGTATACCCTGTTCGTGGCA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PXR Polyclonal Antibody, AbBy Fluor™ 680 Conjugated
bs-2334R-BF680-TR 20 µL

PXR Polyclonal Antibody, AbBy Fluor™ 680 Conjugated

Sign In for Pricing
View Details
Anti-Human CD107a/LAMP1 Antibody (Mab1), APC
HY332137-01 1 Each

Anti-Human CD107a/LAMP1 Antibody (Mab1), APC

Sign In for Pricing
View Details
Anti-Human CD107a/LAMP1 Antibody (Mab1), APC
HY332137-02 100 Tests

Anti-Human CD107a/LAMP1 Antibody (Mab1), APC

Sign In for Pricing
View Details
FGF-14 (m) -PR
sc-39471-PR 10 µM - 20 µL

FGF-14 (m) -PR

Sign In for Pricing
View Details
Recombinant Mouse KxDL motif-containing protein 1 (Kxd1)
MBS1482894-01 0.02 mg (E-Coli)

Recombinant Mouse KxDL motif-containing protein 1 (Kxd1)

Sign In for Pricing
View Details
Recombinant Mouse KxDL motif-containing protein 1 (Kxd1)
MBS1482894-02 0.1 mg (E-Coli)

Recombinant Mouse KxDL motif-containing protein 1 (Kxd1)

Sign In for Pricing
View Details