Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD226/DNAM-1 Recombinant Protein

Product Specifications

Background

DNAM-1/CD226 is a member of the immunoglobulin-like superfamily. It is expressed on T cells, natural killer (NK) cells, monocytes, and macrophages. It is a major activating receptor on NK cells. Engagement with its ligands Nectin-2 (CD112) and PVR (poliovirus receptor, also known as CD155) on the target cells leads to downstream activation of ERK, AKT, and PLCg2 signaling pathways that are crucial for NK activation and NK-mediated killing. LFA-1 physically associates with DNAM-1/CD226 and contributes to its signaling. Activating signal of DNAM-1/CD226 is counterbalanced by inhibitory receptors TIGIT and CD96, competing for the common ligands CD122 and PVR.

CAS Number

9000-83-3

Swiss Prot

Q15762

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~26kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAGAAGTTCTGTGGCATACCAGTGTTCCGTTCGCAGAAAATATGAGTCTGGAATGCGTGTATCCGAGTATGGGTATTCTGACCCAGGTGGAATGGTTCAAAATTGGTACCCAGCAGGATAGCATTGCAATCTTCAGTCCGACCCATGGTATGGTGATTCGCAAACCGTATGCAGAACGTGTGTACTTCCTGAATAGCACCATGGCCAGCAATAATATGACCCTGTTCTTCCGCAATGCCAGTGAAGATGATGTTGGCTATTATAGCTGTAGCCTGTATACCTATCCGCAGGGCACCTGGCAGAAAGTGATTCAGGTGGTTCAGAGTGATAGCTTCGAAGCAGCAGTTCCGAGCAATAGCCATATTGTGAGCGAACCGGGTAAAAATGTGACCCTGACCTGTCAGCCGCAGATGACCTGGCCGGTGCAGGCAGTTCGCTGGGAAAAAATTCAGCCGCGCCAGATTGATCTGCTGACCTATTGCAATCTGGTGCATGGCCGTAACTTCACCAGTAAATTCCCGCGTCAGATTGTGAGTAATTGTAGTCATGGCCGTTGGAGCGTTATTGTGATTCCGGATGTGACCGTTAGCGATAGTGGCCTGTATCGCTGTTATCTGCAGGCAAGCGCAGGCGAAAATGAAACCTTCGTGATGCGCCTGACCGTTGCAGAAGGTAAAACCGATAATCAGTATACCCTGTTCGTGGCA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Pseudohypericin
sc-202777A 5 mg

Pseudohypericin

Sign In for Pricing
View Details
Anti-LYPA2 antibody
STJ190508 200 µl

Anti-LYPA2 antibody

Sign In for Pricing
View Details
Progerin (13A4D4) Alexa Fluor® 594
sc-81611 AF594 200 µg/mL

Progerin (13A4D4) Alexa Fluor® 594

Sign In for Pricing
View Details
OBhFc1 Protein, Human, Recombinant (His)
TMPJ-00516-01 5 µg

OBhFc1 Protein, Human, Recombinant (His)

Sign In for Pricing
View Details
OBhFc1 Protein, Human, Recombinant (His)
TMPJ-00516-02 10 µg

OBhFc1 Protein, Human, Recombinant (His)

Sign In for Pricing
View Details
OBhFc1 Protein, Human, Recombinant (His)
TMPJ-00516-03 20 µg

OBhFc1 Protein, Human, Recombinant (His)

Sign In for Pricing
View Details