Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD209 Recombinant Protein

Product Specifications

Background

DC-SIGN (CD209, CLEC4L) is a C-type lectin receptor expressed by dendritic cells (DCs) . The DC-SIGN transcript can undergo several splicing events to generate at least thirteen different transmembrane and soluble isoforms. DC-SIGN responds to a broad range of pathogens due to its ability to recognize both mannose and fructose carbohydrates, and is well studied for its role in HIV infection. Recognition of the HIV envelope glycoprotein gp120 by DC-SIGN leads to internalization of HIV by DCs and facilitates transmission of the virus to CD4+ T cells. DC-SIGN also mediates adhesion to T cells through interaction with ICAM-3, as well as transmigration across the endothelium by binding to ICAM-2. The DC-SIGN receptor can modulate TLR signaling by activating the kinase Raf-1. The closely related molecule DC-SIGNR (L-SIGN, CLEC4M) is 77% homologous to DC-SIGN and likely arose through a gene duplication event. Like DC-SIGN, DC-SIGNR binds mannose carbohydrates on the surface of pathogens. However, the expression patterns of the two receptors differ, as DC-SIGNR expression is restricted to endothelial cells of the liver, lymph node, and placenta. Murine cells contain a set of related molecules, SIGNR1-SIGNR8. Based on sequence analysis, there is no clear murine ortholog to human DC-SIGN, however SIGNR3 is the most functionally similar due to its ability to recognize both mannose and fructose structures.

CAS Number

9000-83-3

Swiss Prot

Q9NNX6

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~38kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGTGAGTAAAGTTCCGAGTAGCATTAGCCAGGAACAGAGTCGCCAGGATGCCATCTATCAGAATCTGACCCAGCTGAAAGCAGCAGTTGGCGAACTGAGTGAAAAAAGCAAACTGCAGGAAATCTATCAGGAACTGACCCAGTTAAAAGCAGCAGTGGGTGAACTGCCGGAAAAAAGCAAGCTGCAGGAAATCTATCAAGAACTGACCCGCCTGAAAGCCGCCGTTGGTGAACTGCCTGAAAAAAGCAAATTACAGGAAATCTATCAGGAGCTGACCTGGCTGAAAGCCGCGGTTGGCGAATTACCGGAAAAAAGTAAAATGCAGGAAATCTATCAGGAATTAACCCGCCTGAAGGCCGCAGTGGGCGAACTGCCGGAGAAAAGTAAACAGCAGGAAATCTATCAGGAACTTACCCGTCTGAAAGCAGCCGTGGGTGAATTACCGGAGAAAAGCAAACAGCAGGAGATCTATCAGGAACTGACACGCCTGAAAGCGGCCGTTGGTGAGCTGCCGGAAAAGAGCAAACAGCAAGAAATCTATCAGGAACTGACGCAGCTGAAAGCGGCAGTGGAACGTCTGTGCCATCCGTGTCCGTGGGAATGGACCTTCTTCCAGGGTAATTGCTACTTCATGAGCAATAGCCAGCGCAATTGGCATGATAGCATTACCGCCTGCAAAGAAGTTGGCGCACAGCTGGTTGTTATTAAAAGTGCAGAAGAACAGAACTTCCTGCAGCTGCAGAGTAGCCGTAGTAATCGCTTCACCTGGATGGGTCTGAGTGATCTGAATCAGGAAGGCACCTGGCAGTGGGTGGATGGCAGCCCGCTGCTGCCGAGCTTCAAACAGTATTGGAATCGCGGTGAACCGAATAATGTTGGTGAAGAAGATTGTGCAGAATTCAGCGGCAATGGTTGGAATGATGATAAATGTAATCTGGCCAAATTCTGGATCTGTAAAAAAAGTGCAGCCAGTTGCAGTCGCGATGAAGAACAGTTCCTGAGTCCGGCCCCGGCCACCCCTAATCCGCCTCCTGCT

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Human TTLL7 Knockout HEK293T cell line
GTR15419542 1 Vial

Human TTLL7 Knockout HEK293T cell line

Ask
View Details
Anti-TNFRSF5/CD40 Reference Antibody (giloralimab)
MBS9247373-01 0.1 mg

Anti-TNFRSF5/CD40 Reference Antibody (giloralimab)

Ask
View Details
Anti-TNFRSF5/CD40 Reference Antibody (giloralimab)
MBS9247373-02 5x 0.1 mg

Anti-TNFRSF5/CD40 Reference Antibody (giloralimab)

Ask
View Details
Recombinant Human Cadherin-12 Protein, His, E.coli-50ug
QP8756-ec-50ug 50ug

Recombinant Human Cadherin-12 Protein, His, E.coli-50ug

Ask
View Details
Recombinant Bacillus licheniformis Tryptophan synthase alpha chain (trpA)
MBS1305568-01 0.02 mg (E-Coli)

Recombinant Bacillus licheniformis Tryptophan synthase alpha chain (trpA)

Ask
View Details
Recombinant Bacillus licheniformis Tryptophan synthase alpha chain (trpA)
MBS1305568-02 0.02 mg (Yeast)

Recombinant Bacillus licheniformis Tryptophan synthase alpha chain (trpA)

Ask
View Details