Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD209 Recombinant Protein

Product Specifications

Background

DC-SIGN (CD209, CLEC4L) is a C-type lectin receptor expressed by dendritic cells (DCs) . The DC-SIGN transcript can undergo several splicing events to generate at least thirteen different transmembrane and soluble isoforms. DC-SIGN responds to a broad range of pathogens due to its ability to recognize both mannose and fructose carbohydrates, and is well studied for its role in HIV infection. Recognition of the HIV envelope glycoprotein gp120 by DC-SIGN leads to internalization of HIV by DCs and facilitates transmission of the virus to CD4+ T cells. DC-SIGN also mediates adhesion to T cells through interaction with ICAM-3, as well as transmigration across the endothelium by binding to ICAM-2. The DC-SIGN receptor can modulate TLR signaling by activating the kinase Raf-1. The closely related molecule DC-SIGNR (L-SIGN, CLEC4M) is 77% homologous to DC-SIGN and likely arose through a gene duplication event. Like DC-SIGN, DC-SIGNR binds mannose carbohydrates on the surface of pathogens. However, the expression patterns of the two receptors differ, as DC-SIGNR expression is restricted to endothelial cells of the liver, lymph node, and placenta. Murine cells contain a set of related molecules, SIGNR1-SIGNR8. Based on sequence analysis, there is no clear murine ortholog to human DC-SIGN, however SIGNR3 is the most functionally similar due to its ability to recognize both mannose and fructose structures.

CAS Number

9000-83-3

Swiss Prot

Q9NNX6

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~38kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGTGAGTAAAGTTCCGAGTAGCATTAGCCAGGAACAGAGTCGCCAGGATGCCATCTATCAGAATCTGACCCAGCTGAAAGCAGCAGTTGGCGAACTGAGTGAAAAAAGCAAACTGCAGGAAATCTATCAGGAACTGACCCAGTTAAAAGCAGCAGTGGGTGAACTGCCGGAAAAAAGCAAGCTGCAGGAAATCTATCAAGAACTGACCCGCCTGAAAGCCGCCGTTGGTGAACTGCCTGAAAAAAGCAAATTACAGGAAATCTATCAGGAGCTGACCTGGCTGAAAGCCGCGGTTGGCGAATTACCGGAAAAAAGTAAAATGCAGGAAATCTATCAGGAATTAACCCGCCTGAAGGCCGCAGTGGGCGAACTGCCGGAGAAAAGTAAACAGCAGGAAATCTATCAGGAACTTACCCGTCTGAAAGCAGCCGTGGGTGAATTACCGGAGAAAAGCAAACAGCAGGAGATCTATCAGGAACTGACACGCCTGAAAGCGGCCGTTGGTGAGCTGCCGGAAAAGAGCAAACAGCAAGAAATCTATCAGGAACTGACGCAGCTGAAAGCGGCAGTGGAACGTCTGTGCCATCCGTGTCCGTGGGAATGGACCTTCTTCCAGGGTAATTGCTACTTCATGAGCAATAGCCAGCGCAATTGGCATGATAGCATTACCGCCTGCAAAGAAGTTGGCGCACAGCTGGTTGTTATTAAAAGTGCAGAAGAACAGAACTTCCTGCAGCTGCAGAGTAGCCGTAGTAATCGCTTCACCTGGATGGGTCTGAGTGATCTGAATCAGGAAGGCACCTGGCAGTGGGTGGATGGCAGCCCGCTGCTGCCGAGCTTCAAACAGTATTGGAATCGCGGTGAACCGAATAATGTTGGTGAAGAAGATTGTGCAGAATTCAGCGGCAATGGTTGGAATGATGATAAATGTAATCTGGCCAAATTCTGGATCTGTAAAAAAAGTGCAGCCAGTTGCAGTCGCGATGAAGAACAGTTCCTGAGTCCGGCCCCGGCCACCCCTAATCCGCCTCCTGCT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human UMOD Protein, N-His
E55P0833 50 µg

Recombinant Human UMOD Protein, N-His

Sign In for Pricing
View Details
Lentiviral human SLC25A23 shRNA (UAS) - Lentiviral human SLC25A23 shRNA (UAS) plasmid
GTR15164863 1 Vial

Lentiviral human SLC25A23 shRNA (UAS) - Lentiviral human SLC25A23 shRNA (UAS) plasmid

Sign In for Pricing
View Details
Munc18 1 (STXBP1) (NM_001032221) Human Recombinant Protein
E45H39611M5 20 µg

Munc18 1 (STXBP1) (NM_001032221) Human Recombinant Protein

Sign In for Pricing
View Details
ALS2CR4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0077707 1.0 µg DNA

ALS2CR4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
Phospho-Smad1 (Ser 463/465) / Smad5 (Ser 463/465) / Smad9 (Ser 465/467) Rabbit mAb
C05126-100uL 100 µL

Phospho-Smad1 (Ser 463/465) / Smad5 (Ser 463/465) / Smad9 (Ser 465/467) Rabbit mAb

Sign In for Pricing
View Details
PE-Linked Polyclonal Antibody to Kallikrein 1 (KLK1)
MBS2050078-01 0.1 mL

PE-Linked Polyclonal Antibody to Kallikrein 1 (KLK1)

Sign In for Pricing
View Details