Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD1D Recombinant Protein

Product Specifications

Background

The CD1 multigene family encodes five forms of the CD1 T cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Adaptor protein complexes and CD1-associated chaperones control CD1 trafficking and the development and activation of CD1-restricted T cells. CD1D is present on human intestinal epithelial cells (IEC) and exists as a β-2-Microglobulinindependent nonglycosylated form or a β-2-Microglobulin-dependent glycosylated form. The human CD1D gene maps to chromosome 1q23.1 and encodes a 335 amino acid protein that influences normal T cell maturation.

CAS Number

9000-83-3

Swiss Prot

P15813

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~31kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAGTGCCGCAGCGTCTGTTCCCGCTGCGCTGCCTGCAGATTAGCAGCTTCGCCAATAGCAGCTGGACCCGTACCGATGGTCTGGCCTGGCTGGGTGAACTGCAGACCCATAGTTGGAGTAATGATAGTGATACCGTGCGCAGTCTGAAACCGTGGAGCCAGGGCACCTTCAGTGATCAGCAGTGGGAAACCTTACAGCATATCTTCCGTGTGTATCGTAGCAGCTTCACCCGTGATGTTAAAGAATTCGCAAAAATGCTGCGTCTGAGCTATCCGCTGGAACTGCAGGTTAGCGCAGGTTGCGAAGTTCATCCGGGCAATGCAAGCAATAACTTCTTCCATGTGGCATTCCAGGGCAAAGATATTCTGAGCTTCCAGGGCACCAGCTGGGAACCGACCCAGGAAGCACCGCTGTGGGTTAATCTGGCAATTCAGGTTCTGAATCAGGATAAATGGACCCGCGAAACCGTGCAGTGGCTGCTGAATGGTACCTGCCCGCAGTTCGTGAGCGGCCTGCTGGAAAGTGGCAAAAGTGAACTGAAAAAACAGGTTAAACCGAAAGCCTGGCTGAGCCGCGGTCCGAGTCCGGGTCCTGGTCGTCTGCTGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTTAAATGGATGCGTGGTGAACAGGAACAGCAGGGCACCCAGCCGGGTGATATTCTGCCGAATGCAGATGAAACCTGGTATCTGCGTGCAACCCTGGATGTTGTTGCAGGCGAAGCCGCAGGTCTGAGCTGCCGTGTTAAACATAGTAGCCTGGAAGGTCAGGATATTGTTCTGTATTGGGGTGGCAGTTATACCAGT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal EEF2K Antibody [Biotin]
NB100-87019B 0.1 mL

Rabbit Polyclonal EEF2K Antibody [Biotin]

Sign In for Pricing
View Details
ZSCAN21 CRISPR Knock Out 293T Cell Line (Human)
51966141 1x 10^6 Cells / 1.0 mL

ZSCAN21 CRISPR Knock Out 293T Cell Line (Human)

Sign In for Pricing
View Details
Human WDR49 qPCR Primer Pair
QH65481S 200 Tests

Human WDR49 qPCR Primer Pair

Sign In for Pricing
View Details
Rsph4a Mouse Gene Knockout Kit (CRISPR)
KN515166 1 Kit

Rsph4a Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Rat Dcaf5 Pre-designed siRNA Set A
SI203576A 1 Each

Rat Dcaf5 Pre-designed siRNA Set A

Sign In for Pricing
View Details
Olr876 Protein Vector (Rat) (pPB-N-His)
PV291451 500 ng

Olr876 Protein Vector (Rat) (pPB-N-His)

Sign In for Pricing
View Details