CD1D Recombinant Protein
Product Specifications
Background
The CD1 multigene family encodes five forms of the CD1 T cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Adaptor protein complexes and CD1-associated chaperones control CD1 trafficking and the development and activation of CD1-restricted T cells. CD1D is present on human intestinal epithelial cells (IEC) and exists as a β-2-Microglobulinindependent nonglycosylated form or a β-2-Microglobulin-dependent glycosylated form. The human CD1D gene maps to chromosome 1q23.1 and encodes a 335 amino acid protein that influences normal T cell maturation.
CAS Number
9000-83-3
Swiss Prot
P15813
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~31kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GAAGTGCCGCAGCGTCTGTTCCCGCTGCGCTGCCTGCAGATTAGCAGCTTCGCCAATAGCAGCTGGACCCGTACCGATGGTCTGGCCTGGCTGGGTGAACTGCAGACCCATAGTTGGAGTAATGATAGTGATACCGTGCGCAGTCTGAAACCGTGGAGCCAGGGCACCTTCAGTGATCAGCAGTGGGAAACCTTACAGCATATCTTCCGTGTGTATCGTAGCAGCTTCACCCGTGATGTTAAAGAATTCGCAAAAATGCTGCGTCTGAGCTATCCGCTGGAACTGCAGGTTAGCGCAGGTTGCGAAGTTCATCCGGGCAATGCAAGCAATAACTTCTTCCATGTGGCATTCCAGGGCAAAGATATTCTGAGCTTCCAGGGCACCAGCTGGGAACCGACCCAGGAAGCACCGCTGTGGGTTAATCTGGCAATTCAGGTTCTGAATCAGGATAAATGGACCCGCGAAACCGTGCAGTGGCTGCTGAATGGTACCTGCCCGCAGTTCGTGAGCGGCCTGCTGGAAAGTGGCAAAAGTGAACTGAAAAAACAGGTTAAACCGAAAGCCTGGCTGAGCCGCGGTCCGAGTCCGGGTCCTGGTCGTCTGCTGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTTAAATGGATGCGTGGTGAACAGGAACAGCAGGGCACCCAGCCGGGTGATATTCTGCCGAATGCAGATGAAACCTGGTATCTGCGTGCAACCCTGGATGTTGTTGCAGGCGAAGCCGCAGGTCTGAGCTGCCGTGTTAAACATAGTAGCCTGGAAGGTCAGGATATTGTTCTGTATTGGGGTGGCAGTTATACCAGT
Available Sizes
More Discoveries
Explore Other Products
Browse additional items from our catalog