CD1A Recombinant Protein
Product Specifications
Background
The CD1 multigene family encodes five forms of the CD1 T-cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with b-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Specifically, CD1A is a marker for Langerhans cell histiocytosis (LCH) and is found on interdigitating cells. Adaptor-protein complexes and CD1-associated chaperones control CD1 trafficking, and the development and activation of CD1-restricted T cells. Constitutive endocytosis of CD1B molecules and the differential sorting of MHC class II from lysosomes separate peptide- and lipid antigen-presenting molecules during dendritic cell maturation. CD1B is also expressed in interdigitating cells. The human CD1 genes are all closely linked in a cluster mapping at chromosome 1q23.1.
CAS Number
9000-83-3
Swiss Prot
P06126
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~31kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
AACGCAGATGGTCTGAAAGAACCGCTGAGCTTCCATGTTACCTGGATTGCAAGCTTCTATAATCATAGCTGGAAACAGAATCTGGTTAGTGGCTGGCTGAGTGATCTGCAGACCCATACCTGGGATAGTAATAGCAGTACCATTGTGTTCCTGTGCCCGTGGAGTCGTGGCAACTTCAGTAATGAAGAATGGAAAGAACTGGAAACCTTATTCCGTATTCGTACCATTCGCAGCTTCGAAGGCATTCGCCGTTATGCCCATGAACTGCAGTTCGAATATCCGTTCGAAATTCAGGTTACCGGTGGCTGCGAACTGCATAGTGGCAAAGTTAGCGGCAGCTTCCTGCAGCTGGCCTATCAGGGTAGTGACTTCGTGAGCTTCCAGAATAATAGTTGGCTGCCGTATCCGGTGGCAGGTAATATGGCAAAACACTTCTGTAAAGTGCTGAATCAGAATCAGCATGAAAATGATATTACCCATAACCTGCTGAGCGATACCTGTCCGCGCTTCATTCTGGGCCTGCTGGATGCCGGTAAAGCACATCTGCAGCGCCAGGTTAAACCGGAAGCCTGGCTGAGTCATGGTCCGAGCCCGGGTCCGGGTCATCTGCAGCTGGTGTGTCATGTTAGTGGCTTCTATCCGAAACCGGTGTGGGTGATGTGGATGCGTGGCGAACAGGAACAGCAGGGTACCCAGCGCGGTGATATTCTGCCGAGCGCCGATGGCACCTGGTATCTGCGTGCCACCCTGGAAGTTGCCGCAGGCGAAGCAGCAGATCTGAGTTGCCGTGTGAAACATAGCAGCCTGGAAGGTCAGGATATTGTGCTGTATTGGGAACATCATAGTAGTGTT
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items