Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD1A Recombinant Protein

Product Specifications

Background

The CD1 multigene family encodes five forms of the CD1 T-cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with b-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Specifically, CD1A is a marker for Langerhans cell histiocytosis (LCH) and is found on interdigitating cells. Adaptor-protein complexes and CD1-associated chaperones control CD1 trafficking, and the development and activation of CD1-restricted T cells. Constitutive endocytosis of CD1B molecules and the differential sorting of MHC class II from lysosomes separate peptide- and lipid antigen-presenting molecules during dendritic cell maturation. CD1B is also expressed in interdigitating cells. The human CD1 genes are all closely linked in a cluster mapping at chromosome 1q23.1.

CAS Number

9000-83-3

Swiss Prot

P06126

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~31kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AACGCAGATGGTCTGAAAGAACCGCTGAGCTTCCATGTTACCTGGATTGCAAGCTTCTATAATCATAGCTGGAAACAGAATCTGGTTAGTGGCTGGCTGAGTGATCTGCAGACCCATACCTGGGATAGTAATAGCAGTACCATTGTGTTCCTGTGCCCGTGGAGTCGTGGCAACTTCAGTAATGAAGAATGGAAAGAACTGGAAACCTTATTCCGTATTCGTACCATTCGCAGCTTCGAAGGCATTCGCCGTTATGCCCATGAACTGCAGTTCGAATATCCGTTCGAAATTCAGGTTACCGGTGGCTGCGAACTGCATAGTGGCAAAGTTAGCGGCAGCTTCCTGCAGCTGGCCTATCAGGGTAGTGACTTCGTGAGCTTCCAGAATAATAGTTGGCTGCCGTATCCGGTGGCAGGTAATATGGCAAAACACTTCTGTAAAGTGCTGAATCAGAATCAGCATGAAAATGATATTACCCATAACCTGCTGAGCGATACCTGTCCGCGCTTCATTCTGGGCCTGCTGGATGCCGGTAAAGCACATCTGCAGCGCCAGGTTAAACCGGAAGCCTGGCTGAGTCATGGTCCGAGCCCGGGTCCGGGTCATCTGCAGCTGGTGTGTCATGTTAGTGGCTTCTATCCGAAACCGGTGTGGGTGATGTGGATGCGTGGCGAACAGGAACAGCAGGGTACCCAGCGCGGTGATATTCTGCCGAGCGCCGATGGCACCTGGTATCTGCGTGCCACCCTGGAAGTTGCCGCAGGCGAAGCAGCAGATCTGAGTTGCCGTGTGAAACATAGCAGCCTGGAAGGTCAGGATATTGTGCTGTATTGGGAACATCATAGTAGTGTT

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Rabbit Polyclonal ADAM28 Antibody [FITC]
NBP2-67246F 0.1 mL

Rabbit Polyclonal ADAM28 Antibody [FITC]

Ask
View Details
CARS1 Recombinant Antibody, APC-Cy5.5 Conjugated
bsm-62444R-APC-Cy5.5 100 µL

CARS1 Recombinant Antibody, APC-Cy5.5 Conjugated

Ask
View Details
Annexin A11 Polyclonal Antibody, PE-Cy5.5 Conjugated
bs-12477R-PE-Cy5.5 100 µL

Annexin A11 Polyclonal Antibody, PE-Cy5.5 Conjugated

Ask
View Details
ACOT9 Antibody - N-terminal region
ARP83457_P050-25UL 25 µL

ACOT9 Antibody - N-terminal region

Ask
View Details