Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD178 Recombinant Protein

Product Specifications

Background

Association of the receptor Fas with its ligand FasL triggers an apoptotic pathway that plays an important role in immune regulation, development, and progression of cancers. Loss of function mutation in either Fas (lpr mice) or FasL (gld mice) leads to lymphadenopathy and splenomegaly as a result of decreased apoptosis in CD4-CD8- T lymphocytes. FasL (CD95L, Apo-1L) is a type II transmembrane protein of 280 amino acids (runs at approximately 40 kDa upon glycosylation) that belongs to the TNF family, which also includes TNF-α, TRAIL, and TWEAK. Binding of FasL to its receptor triggers the formation of a death-inducing signaling complex (DISC) involving the recruitment of the adaptor protein FADD and caspase-8. Activation of caspase-8 from this complex initiates a caspase cascade resulting in the activation of caspase-3 and subsequent cleavage of proteins leading to apoptosis. Unlike Fas, which is constitutively expressed by various cell types, FasL is predominantly expressed on activated T lymphocytes, NK cells, and at immune privileged sites. FasL is also expressed in several tumor types as a mechanism to evade immune surveillance. Similar to other members of the TNF family, FasL can be cleaved by metalloproteinases producing a 26 kDa trimeric soluble form.

CAS Number

9000-83-3

Swiss Prot

P48023

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~20kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGCTGTTCCATCTGCAGAAAGAACTGGCAGAACTGCGTGAAAGTACCAGCCAGATGCATACCGCAAGCAGTCTGGAAAAACAGATTGGCCATCCGAGCCCGCCGCCGGAAAAAAAAGAACTGCGCAAAGTTGCCCATCTGACCGGCAAAAGTAATAGTCGCAGTATGCCGCTGGAATGGGAAGATACCTATGGCATTGTGCTGCTGAGCGGTGTGAAATATAAAAAAGGCGGCCTGGTTATTAATGAAACCGGCCTGTACTTCGTGTATAGTAAAGTGTACTTCCGTGGTCAGAGCTGCAATAATCTGCCGCTGAGTCATAAAGTGTATATGCGTAATAGTAAGTACCCGCAGGATCTGGTTATGATGGAAGGTAAAATGATGAGTTATTGTACCACCGGTCAGATGTGGGCCCGCAGTAGCTATCTGGGTGCCGTGTTCAATCTGACCAGTGCCGATCATCTGTATGTGAATGTTAGCGAACTGAGCCTGGTTAACTTCGAAGAAAGCCAGACCTTCTTCGGCCTGTATAAACTG

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Filter tip, 1000uL, low retention, 96/rack
150935 1920/CS

Filter tip, 1000uL, low retention, 96/rack

Sign In for Pricing
View Details
Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)
MBS1234526-01 0.02 mg (E-Coli)

Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)

Sign In for Pricing
View Details
Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)
MBS1234526-02 0.1 mg (E-Coli)

Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)

Sign In for Pricing
View Details
Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)
MBS1234526-03 0.02 mg (Yeast)

Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)

Sign In for Pricing
View Details
Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)
MBS1234526-04 0.1 mg (Yeast)

Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)

Sign In for Pricing
View Details
Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)
MBS1234526-05 0.02 mg (Baculovirus)

Recombinant Invertebrate iridescent virus 6 Putative RING finger protein 095L (IIV6-095L)

Sign In for Pricing
View Details