Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD171/N-CAML1 Recombinant Protein

Product Specifications

Background

Neural cell adhesion molecule L1 (NCAM-L1/L1CAM) is a single pass transmembrane glycoprotein member of the immunoglobulin superfamily, containing six amino-terminal extracellular Ig-like domains followed by five fibronectin type-III domains. NCAM-L1 is mainly expressed in the brain, and plays an important role in the developing nervous system, with involvement in neurite fasciculation and outgrowth, myelination, neuronal migration, and neuronal cell adhesion. Mutations in the NCAM-L1 gene cause varying degrees of neurological disease including X-linked hydrocephalus, MASA syndrome, spastic paraplegia type 1, and X-linked corpus callosum agenesis, together known as L1 syndrome. Apart from the nervous system, NCAM-L1 is overexpressed in many cancers and supports a poor prognosis by facilitating aggressive tumor growth, metastasis and chemoresistance.

CAS Number

9000-83-3

Swiss Prot

P32004

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~36kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGGTAAAGGCCCGGAACCGCAGGTGACCATTGGTTATAGCGGTGAAGATTATCCGCAGGCAATTCCGGAACTGGAAGGTATTGAAATTCTGAATAGCAGTGCCGTGCTGGTTAAATGGCGCCCGGTGGATCTGGCCCAGGTGAAAGGTCATCTGCGCGGTTATAATGTTACCTATTGGCGTGAAGGTAGCCAGCGTAAACATAGCAAACGTCATATTCATAAAGACCATGTGGTTGTGCCGGCCAATACCACCAGCGTGATTCTGAGCGGTCTGCGTCCGTATAGCAGTTATCATCTGGAAGTTCAGGCCTTCAATGGCCGCGGCAGCGGCCCTGCTAGTGAATTCACCTTCAGCACCCCGGAAGGTGTTCCGGGCCATCCGGAAGCACTGCATCTGGAATGCCAGAGTAATACCAGTCTGCTGCTGCGTTGGCAGCCGCCGCTGAGTCATAATGGCGTTCTGACCGGTTATGTGCTGAGCTATCATCCGCTGGATGAAGGTGGCAAAGGTCAGCTGAGCTTCAATCTGCGCGATCCGGAACTGCGTACCCATAATCTGACCGATCTGAGTCCGCATCTGCGCTATCGCTTCCAGCTGCAGGCAACCACCAAAGAAGGCCCGGGTGAAGCCATTGTGCGCGAAGGTGGTACCATGGCACTGAGTGGTATTAGTGACTTCGGCAATATTAGTGCCACCGCAGGTGAAAATTATAGTGTTGTGAGTTGGGTGCCGAAAGAAGGTCAGTGTAACTTCCGCTTCCATATTCTGTTCAAAGCACTGGGCGAAGAAAAAGGCGGCGCCAGCCTGAGTCCGCAGTATGTGAGTTATAATCAGAGTAGTTATACCCAGTGGGATCTGCAGCCGGATACCGATTATGAAATTCATCTGTTCAAAGAACGCATGTTCCGCCATCAGATGGCCGTGAAAACCAATGGCACCGGTCGTGTTCGTCTGCCGCCGGCAGGCTTCGCAACCGAA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

iFluor™ 488 Conjugated p75 NGF Receptor Recombinant Rabbit Monoclonal Antibody [SA39-02]
HA720190F 100 µL

iFluor™ 488 Conjugated p75 NGF Receptor Recombinant Rabbit Monoclonal Antibody [SA39-02]

Sign In for Pricing
View Details
Mouse IFN gamma Recombinant Rabbit monoclonal Antibody
HA723676 100 µL

Mouse IFN gamma Recombinant Rabbit monoclonal Antibody

Sign In for Pricing
View Details
Human PABIR1 activation kit by CRISPRa
GA114576 1 Kit

Human PABIR1 activation kit by CRISPRa

Sign In for Pricing
View Details
Mouse Antxr1 activation kit by CRISPRa
GA208217 1 Kit

Mouse Antxr1 activation kit by CRISPRa

Sign In for Pricing
View Details
TTC9B (NM_152479) Human Over-expression Lysate
LC403470 20 µg

TTC9B (NM_152479) Human Over-expression Lysate

Sign In for Pricing
View Details
CELA3B / ELA3B (Pancreatic Function Marker) (CELA3B/1758), CF568 conjugate, 0.1mg/mL
BNC681758-500 1x 500 µL

CELA3B / ELA3B (Pancreatic Function Marker) (CELA3B/1758), CF568 conjugate, 0.1mg/mL

Sign In for Pricing
View Details