Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD160 Recombinant Protein

Product Specifications

Background

CD160 antigen: rceptor on immune cells capable to deliver stimulatory or inhibitory signals that regulate cell activation and differentiation. Exists as a GPI-anchored and as a transmembrane form, each likely initiating distinct signaling pathways via phosphoinositol 3-kinase in activated NK cells and via LCK and CD247/CD3 zeta chain in activated T cells.

CAS Number

9000-83-3

Swiss Prot

O95971

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTTGCATTAATATCACCAGTAGTGCAAGCCAGGAAGGTACCCGCCTGAATCTGATCTGTACCGTGTGGCATAAAAAAGAAGAAGCCGAAGGCTTCGTTGTGTTCCTGTGTAAAGATCGTAGTGGTGATTGCAGTCCGGAAACCAGCCTGAAACAGCTGCGCCTGAAACGTGATCCGGGCATTGATGGTGTTGGCGAAATTAGTAGCCAGCTGATGTTCACCATTAGCCAGGTTACCCCGCTGCATAGTGGCACCTATCAGTGCTGCGCACGTAGTCAGAAAAGTGGTATTCGTCTGCAGGGCCACTTCTTCAGTATTCTGTTCACCGAAACCGGCAATTATACCGTTACCGGCCTGAAACAGCGCCAGCATCTGGAATTCAGCCATAATGAAGGCACCCTGAGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mortality Factor 4 (MORF4, CSR, SEN, CSRB, SEN1) (MaxLight 750) discontinued
M4675-71-ML750 100 µL

Mortality Factor 4 (MORF4, CSR, SEN, CSRB, SEN1) (MaxLight 750) discontinued

Sign In for Pricing
View Details
CCND3 Conjugated Antibody
orb1621215 100 µL

CCND3 Conjugated Antibody

Sign In for Pricing
View Details
FCRL5 Rabbit pAb
A13803-01 20 µL

FCRL5 Rabbit pAb

Sign In for Pricing
View Details
FCRL5 Rabbit pAb
A13803-02 100 μL

FCRL5 Rabbit pAb

Sign In for Pricing
View Details
FCRL5 Rabbit pAb
A13803-03 500 μL

FCRL5 Rabbit pAb

Sign In for Pricing
View Details
FCRL5 Rabbit pAb
A13803-04 1000 μL

FCRL5 Rabbit pAb

Sign In for Pricing
View Details