Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD160 Recombinant Protein

Product Specifications

Background

CD160 antigen: rceptor on immune cells capable to deliver stimulatory or inhibitory signals that regulate cell activation and differentiation. Exists as a GPI-anchored and as a transmembrane form, each likely initiating distinct signaling pathways via phosphoinositol 3-kinase in activated NK cells and via LCK and CD247/CD3 zeta chain in activated T cells.

CAS Number

9000-83-3

Swiss Prot

O95971

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTTGCATTAATATCACCAGTAGTGCAAGCCAGGAAGGTACCCGCCTGAATCTGATCTGTACCGTGTGGCATAAAAAAGAAGAAGCCGAAGGCTTCGTTGTGTTCCTGTGTAAAGATCGTAGTGGTGATTGCAGTCCGGAAACCAGCCTGAAACAGCTGCGCCTGAAACGTGATCCGGGCATTGATGGTGTTGGCGAAATTAGTAGCCAGCTGATGTTCACCATTAGCCAGGTTACCCCGCTGCATAGTGGCACCTATCAGTGCTGCGCACGTAGTCAGAAAAGTGGTATTCGTCTGCAGGGCCACTTCTTCAGTATTCTGTTCACCGAAACCGGCAATTATACCGTTACCGGCCTGAAACAGCGCCAGCATCTGGAATTCAGCCATAATGAAGGCACCCTGAGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Abnormal Prothrombin (APT) Guinea Pig ELISA Kit
B6360 96 Tests

Abnormal Prothrombin (APT) Guinea Pig ELISA Kit

Sign In for Pricing
View Details
NDUFV2 (33-249, His-tag) Human Protein
AR51137PU-N 500 µg

NDUFV2 (33-249, His-tag) Human Protein

Sign In for Pricing
View Details
Olfr1107 sgRNA CRISPR Lentivector set (Mouse)
K4137301 3x 1.0 µg

Olfr1107 sgRNA CRISPR Lentivector set (Mouse)

Sign In for Pricing
View Details
Mrpl11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4764107 1.0 µg DNA

Mrpl11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

Sign In for Pricing
View Details
HAVCR1/KIM-1 Antibody
orb1537725 50 µg

HAVCR1/KIM-1 Antibody

Sign In for Pricing
View Details
Anti-SLC25A25 Antibody Picoband®, iFluor647 Conjugate
A09109-1-iFluor647 100 µg

Anti-SLC25A25 Antibody Picoband®, iFluor647 Conjugate

Sign In for Pricing
View Details