Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD158 Recombinant Protein

Product Specifications

Background

NKAT (NK-associated transcripts) gene products, known as killer immunoglobulin-like receptors or KIRs, downregulate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecules on target cells. This family of receptors is characterized by an extracellular region with two to three immunoglobulin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM) . KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif) . The human inhibitory natural killer cell immunoglobulin-like receptor 2DL1, also designated KIR2DL1, CL-42, NKAT1, P58.1 or CD158a long form, is a 348 amino acid type I transmembrane protein. KIR2DL1 can bind human leukocyte antigen-C (HLA-C) via both polar and hydrophobic interactions through Met 44 in a binding pocket that coordinates Lys 80 of HLA-C.

CAS Number

9000-83-3

Swiss Prot

P43627

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CATGAAGGTGTTCATCGTAAACCGAGTCTGCTGGCCCATCCGGGTCGCCTGGTTAAAAGCGAAGAAACCGTTATTCTGCAGTGTTGGAGTGATGTTCGCTTCGAACACTTCCTGCTGCATCGCGAAGGCAAATTCAAAGATACCCTGCATCTGATTGGTGAACATCATGATGGCGTTAGCAAAGCAAACTTCAGCATTGGTCCGATGATGCAGGATCTGGCAGGCACCTATCGCTGCTATGGTAGCGTTACCCATAGCCCGTATCAGCTGAGTGCACCGAGTGATCCGCTGGATATTGTTATTACCGGCCTGTATGAAAAACCGAGCCTGAGTGCCCAGCCGGGTCCGACAGTTCTGGCCGGTGAAAGTGTTACCCTGAGTTGCAGCAGTCGCAGCAGCTATGATATGTATCATCTGAGCCGTGAAGGTGAAGCACATGAATGCCGCTTCAGTGCAGGTCCGAAAGTGAATGGTACCTTCCAGGCCGACTTCCCGCTGGGTCCGGCCACACATGGTGGCACCTATCGTTGCTTCGGCAGCTTCCGCGATAGTCCGTATGAATGGAGCAATAGCAGTGATCCGTTACTGGTTAGCGTTATTGGTAATCCGAGCAATAGTTGGCCGAGCCCGACCGAACCGAGTAGCAAAACCGGTAATCCGCGTCATCTGCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Bovine Leukocyte antigen A ELISA Kit
OM621698 96 Strip Well

Bovine Leukocyte antigen A ELISA Kit

Sign In for Pricing
View Details
Acid sphingomyelinase Antibody, Cy5 Conjugated
bs-6318R-Cy5-TR 20 µL

Acid sphingomyelinase Antibody, Cy5 Conjugated

Sign In for Pricing
View Details
copine 6 Lentiviral Activation Particles (h2)
sc-411274-LAC-2 200 µL

copine 6 Lentiviral Activation Particles (h2)

Sign In for Pricing
View Details
PE Anti-Rat CD4 (domain 1) Antibody (OX-38)
PE-30012U-01 25 µg

PE Anti-Rat CD4 (domain 1) Antibody (OX-38)

Sign In for Pricing
View Details
PE Anti-Rat CD4 (domain 1) Antibody (OX-38)
PE-30012U-02 100 µg

PE Anti-Rat CD4 (domain 1) Antibody (OX-38)

Sign In for Pricing
View Details
DYNLL1 Rabbit Polyclonal Antibody
orb666533-01 30 µL

DYNLL1 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details