CD158 Recombinant Protein
Product Specifications
Background
NKAT (NK-associated transcripts) gene products, known as killer immunoglobulin-like receptors or KIRs, downregulate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecules on target cells. This family of receptors is characterized by an extracellular region with two to three immunoglobulin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM) . KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif) . The human inhibitory natural killer cell immunoglobulin-like receptor 2DL1, also designated KIR2DL1, CL-42, NKAT1, P58.1 or CD158a long form, is a 348 amino acid type I transmembrane protein. KIR2DL1 can bind human leukocyte antigen-C (HLA-C) via both polar and hydrophobic interactions through Met 44 in a binding pocket that coordinates Lys 80 of HLA-C.
CAS Number
9000-83-3
Swiss Prot
P43627
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~30kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CATGAAGGTGTTCATCGTAAACCGAGTCTGCTGGCCCATCCGGGTCGCCTGGTTAAAAGCGAAGAAACCGTTATTCTGCAGTGTTGGAGTGATGTTCGCTTCGAACACTTCCTGCTGCATCGCGAAGGCAAATTCAAAGATACCCTGCATCTGATTGGTGAACATCATGATGGCGTTAGCAAAGCAAACTTCAGCATTGGTCCGATGATGCAGGATCTGGCAGGCACCTATCGCTGCTATGGTAGCGTTACCCATAGCCCGTATCAGCTGAGTGCACCGAGTGATCCGCTGGATATTGTTATTACCGGCCTGTATGAAAAACCGAGCCTGAGTGCCCAGCCGGGTCCGACAGTTCTGGCCGGTGAAAGTGTTACCCTGAGTTGCAGCAGTCGCAGCAGCTATGATATGTATCATCTGAGCCGTGAAGGTGAAGCACATGAATGCCGCTTCAGTGCAGGTCCGAAAGTGAATGGTACCTTCCAGGCCGACTTCCCGCTGGGTCCGGCCACACATGGTGGCACCTATCGTTGCTTCGGCAGCTTCCGCGATAGTCCGTATGAATGGAGCAATAGCAGTGATCCGTTACTGGTTAGCGTTATTGGTAATCCGAGCAATAGTTGGCCGAGCCCGACCGAACCGAGTAGCAAAACCGGTAATCCGCGTCATCTGCAT
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog