Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD15 Recombinant Protein

Product Specifications

Background

SSEA-1 antibody detects a lactoseries oligosaccharide antigen that is expressed on the surface of mouse embryonal carcinoma and embryonic stem cells. This antigen is also found on early mouse embryos and both mouse and human germ cells, but is absent on human embryonic stem cells and human embryonic carcinoma cells. Expression of SSEA1 in these human cell types increases upon differentiation, while on the mouse cell types differentiation leads to decreased expression.

CAS Number

9000-83-3

Swiss Prot

P22083

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~44kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTCAGCTGCCGCCTCTGCCTTGGGCCAGCCCTACCCCTAGCCGCCCTGTTGGTGTTCTGCTGTGGTGGGAACCGTTCGGCGGCCGTGATAGTGCCCCGCGTCCGCCTCCTGATTGCCGCTTACGCTTCAATATTAGCGGTTGCCGCCTGCTGACCGATCGTGCAAGTTATGGCGAAGCACAGGCAGTGCTGTTCCATCATCGCGATCTGGTGAAAGGTCCGCCGGATTGGCCGCCGCCGTGGGGTATTCAGGCACATACCGCCGAAGAAGTTGATCTGCGCGTTCTGGATTATGAAGAAGCCGCCGCCGCAGCCGAAGCACTGGCTACAAGTAGTCCGCGTCCGCCGGGTCAGCGCTGGGTGTGGATGAACTTCGAAAGCCCGAGCCATAGCCCGGGTCTGCGCAGTCTGGCAAGCAATCTGTTCAATTGGACCCTGAGCTATCGTGCAGATAGCGATGTGTTCGTTCCGTATGGCTATCTGTATCCGCGTAGCCATCCGGGCGATCCGCCGTCAGGTCTGGCACCTCCGCTGAGCCGCAAACAGGGCCTGGTTGCCTGGGTTGTGAGCCATTGGGATGAACGTCAGGCCCGTGTGCGCTATTATCATCAGCTGAGTCAGCATGTGACCGTGGATGTGTTCGGTCGTGGCGGTCCGGGTCAGCCGGTGCCTGAAATTGGCCTGCTGCATACCGTGGCACGTTATAAATTCTATCTGGCCTTCGAAAATAGTCAGCATCTGGATTATATTACCGAAAAACTGTGGCGCAATGCACTGCTGGCCGGTGCCGTTCCGGTGGTTCTGGGTCCGGATCGTGCCAATTATGAACGCTTCGTTCCGCGCGGCGCATTCATTCATGTTGATGACTTCCCGAGTGCAAGCAGTCTGGCAAGTTATCTGCTGTTCCTGGATCGTAATCCGGCAGTGTATCGCCGTTACTTCCATTGGCGCCGTAGCTATGCCGTGCATATTACCAGCTTCTGGGATGAACCGTGGTGCCGCGTGTGTCAGGCAGTTCAGCGTGCAGGCGATCGCCCGAAAAGCATTCGCAATCTGGCAAGCTGGTTCGAACGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

HuCC49 Human Monoclonal Antibody
orb2978002-01 100 µg

HuCC49 Human Monoclonal Antibody

Sign In for Pricing
View Details
HuCC49 Human Monoclonal Antibody
orb2978002-02 1 mg

HuCC49 Human Monoclonal Antibody

Sign In for Pricing
View Details
Recombinant Danio rerio Claudin-7-B (cldn7b)
orb2918053-01 20 µg

Recombinant Danio rerio Claudin-7-B (cldn7b)

Sign In for Pricing
View Details
Recombinant Danio rerio Claudin-7-B (cldn7b)
orb2918053-02 100 µg

Recombinant Danio rerio Claudin-7-B (cldn7b)

Sign In for Pricing
View Details
(2-Piperidinyl) (1-pyrrolidinyl) methanone hydrochloride
QCB63481 2.5 g

(2-Piperidinyl) (1-pyrrolidinyl) methanone hydrochloride

Sign In for Pricing
View Details
Adenylate Kinase 1 (Adenylate Kinase Isoenzyme 1, AK 1, AK1, AK-1, Adenylate Kinase Soluble, ATP-AMP Transphosphorylase, Myokinase) (MaxLight 490)
MBS6199043-01 0.1 mL

Adenylate Kinase 1 (Adenylate Kinase Isoenzyme 1, AK 1, AK1, AK-1, Adenylate Kinase Soluble, ATP-AMP Transphosphorylase, Myokinase) (MaxLight 490)

Sign In for Pricing
View Details