Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD136/RON Recombinant Protein

Product Specifications

Background

Ron is a member of the Met protooncogene family of receptor tyrosine kinases, which also includes Stk, c-Met, and c-Sea. The functional Ron is a heterodimer composed of a 40 kDa α chain and a 150 kDa β chain. Ron is initially synthesized in the cells as a single-chain, pro-Ron precursor that is cleaved into the two active chains. The α chain is completely extracellular, whereas the β chain traverses the cell membrane and contains the intracellular tyrosine kinase and regulatory elements. Ron mediates multiple signaling cascades that involve cell motility, adhesion, proliferation, and apoptosis. The signaling pathways activated downstream of Ron include the ras/mitogen-activated protein kinase (MAPK), phosphatidyl inositol-3 kinase (PI3K) /Akt, and focal adhesion kinase (FAK) pathways. Ron activation can also significantly increase c-Src activity, a signaling intermediate involved in cell cycle progression, motility, angiogenesis and survival. The function of Ron has been shown to be important for embryological development as well as implicated in the progression and metastasis of tumors.

CAS Number

9000-83-3

Swiss Prot

Q04912

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~32kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTAGCTTCAGCGATAGTGAAGATGAAAGTTGTGTTCCGCTGCTGCGCAAAGAAAGTATTCAGCTGCGTGATCTGGATAGCGCACTGCTGGCCGAAGTGAAAGATGTTCTGATTCCGCATGAACGTGTGGTTACCCATAGTGATCGCGTGATTGGCAAAGGTCACTTCGGTGTGGTGTATCATGGTGAATATATTGATCAGGCACAGAATCGCATTCAGTGTGCCATTAAAAGCCTGAGTCGCATTACCGAAATGCAGCAGGTTGAAGCATTCCTGCGCGAAGGTCTGCTGATGCGCGGTCTGAATCATCCGAATGTGCTGGCCCTGATTGGTATTATGCTGCCGCCGGAAGGCCTGCCGCATGTGCTGCTGCCGTATATGTGCCATGGCGATCTGCTGCAGTTCATTCGTAGCCCGCAGCGTAATCCGACCGTGAAAGATCTGATTAGCTTCGGTCTGCAGGTTGCCCGTGGCATGGAATATCTGGCCGAACAGAAATTCGTGCATCGTGATCTGGCCGCACGCAATTGCATGCTGGATGAAAGCTTCACCGTGAAAGTTGCCGACTTCGGCCTGGCACGCGATATTCTGGATCGTGAATATTATAGTGTGCAGCAGCATCGTCATGCCCGCCTGCCGGTGAAATGGATGGCCCTGGAAAGTCTGCAGACCTATCGCTTCACCACCAAAAGTGATGTGTGGAGCTTCGGCGTGCTGCTGTGGGAACTGCTGACCCGCGGCGCCCCTCCTTATCGCCATATTGATCCGTTCGATCTGACCCACTTCCTGGCCCAGGGTCGCCGCCTGCCTCAGCCTGAATATTGTCCGGATAGTCTGTATCAGGTTATGCAGCAGTGCTGGGAAGCAGATCCGGCCGTTCGCCCG

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

YARS2 Protein Vector (Human) (pPM-C-HA)
PV046667 500 ng

YARS2 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
Active Eosinophil Chemotactic Factor (ECF)
SBPA012Hu01-01 10 µg

Active Eosinophil Chemotactic Factor (ECF)

Sign In for Pricing
View Details
Active Eosinophil Chemotactic Factor (ECF)
SBPA012Hu01-02 50 µg

Active Eosinophil Chemotactic Factor (ECF)

Sign In for Pricing
View Details
Active Eosinophil Chemotactic Factor (ECF)
SBPA012Hu01-03 200 µg

Active Eosinophil Chemotactic Factor (ECF)

Sign In for Pricing
View Details
Active Eosinophil Chemotactic Factor (ECF)
SBPA012Hu01-04 1 mg

Active Eosinophil Chemotactic Factor (ECF)

Sign In for Pricing
View Details
Active Eosinophil Chemotactic Factor (ECF)
SBPA012Hu01-05 5 mg

Active Eosinophil Chemotactic Factor (ECF)

Sign In for Pricing
View Details