CD136/RON Recombinant Protein
Product Specifications
Background
Ron is a member of the Met protooncogene family of receptor tyrosine kinases, which also includes Stk, c-Met, and c-Sea. The functional Ron is a heterodimer composed of a 40 kDa α chain and a 150 kDa β chain. Ron is initially synthesized in the cells as a single-chain, pro-Ron precursor that is cleaved into the two active chains. The α chain is completely extracellular, whereas the β chain traverses the cell membrane and contains the intracellular tyrosine kinase and regulatory elements. Ron mediates multiple signaling cascades that involve cell motility, adhesion, proliferation, and apoptosis. The signaling pathways activated downstream of Ron include the ras/mitogen-activated protein kinase (MAPK), phosphatidyl inositol-3 kinase (PI3K) /Akt, and focal adhesion kinase (FAK) pathways. Ron activation can also significantly increase c-Src activity, a signaling intermediate involved in cell cycle progression, motility, angiogenesis and survival. The function of Ron has been shown to be important for embryological development as well as implicated in the progression and metastasis of tumors.
CAS Number
9000-83-3
Swiss Prot
Q04912
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~32kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GCTAGCTTCAGCGATAGTGAAGATGAAAGTTGTGTTCCGCTGCTGCGCAAAGAAAGTATTCAGCTGCGTGATCTGGATAGCGCACTGCTGGCCGAAGTGAAAGATGTTCTGATTCCGCATGAACGTGTGGTTACCCATAGTGATCGCGTGATTGGCAAAGGTCACTTCGGTGTGGTGTATCATGGTGAATATATTGATCAGGCACAGAATCGCATTCAGTGTGCCATTAAAAGCCTGAGTCGCATTACCGAAATGCAGCAGGTTGAAGCATTCCTGCGCGAAGGTCTGCTGATGCGCGGTCTGAATCATCCGAATGTGCTGGCCCTGATTGGTATTATGCTGCCGCCGGAAGGCCTGCCGCATGTGCTGCTGCCGTATATGTGCCATGGCGATCTGCTGCAGTTCATTCGTAGCCCGCAGCGTAATCCGACCGTGAAAGATCTGATTAGCTTCGGTCTGCAGGTTGCCCGTGGCATGGAATATCTGGCCGAACAGAAATTCGTGCATCGTGATCTGGCCGCACGCAATTGCATGCTGGATGAAAGCTTCACCGTGAAAGTTGCCGACTTCGGCCTGGCACGCGATATTCTGGATCGTGAATATTATAGTGTGCAGCAGCATCGTCATGCCCGCCTGCCGGTGAAATGGATGGCCCTGGAAAGTCTGCAGACCTATCGCTTCACCACCAAAAGTGATGTGTGGAGCTTCGGCGTGCTGCTGTGGGAACTGCTGACCCGCGGCGCCCCTCCTTATCGCCATATTGATCCGTTCGATCTGACCCACTTCCTGGCCCAGGGTCGCCGCCTGCCTCAGCCTGAATATTGTCCGGATAGTCTGTATCAGGTTATGCAGCAGTGCTGGGAAGCAGATCCGGCCGTTCGCCCG
Available Sizes
More Discoveries
Explore Other Products
Browse additional items from our catalog