Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD109 Recombinant Protein

Product Specifications

Background

CD109 is a glycosylphosphatidylinositol (GPI) -linked glycoprotein that belongs to the alpha2-macroglobulin family of thioester containing proteins. CD109 is associated with TGF-beta receptor I (TbRI) and inhibits TGF-beta signaling. Cleavage of CD109 at its Furin cleavage site results in the release of its large amino-terminal domain, which then binds to the TGF-beta receptor I to inhibit TGF-beta signaling. CD109 is expressed on a subset of CD34+ bone marrow cells and mesenchymal stem cells, activated platelets, activated T cells, endothelial cells, and a wide variety of tumors. Elevated CD109 expression has been considered a diagnostic/prognostic marker for several types of cancers.

CAS Number

9000-83-3

Swiss Prot

Q6YHK3

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~36kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGAGCAGTGTGGGCAGCCCGAAAGCAAAAGAAGCACTGAATATGCTGACCTGGCGCGCAGAACAGGAAGGTGGCATGCAGTTCTGGGTGAGCAGTGAAAGCAAACTGAGCGATAGTTGGCAGCCGCGTAGCCTGGATATTGAAGTTGCAGCCTATGCACTGCTGAGTCACTTCCTGCAGTTCCAGACCAGCGAAGGTATTCCGATTATGCGTTGGCTGAGCCGTCAGCGCAATAGTCTGGGCGGCTTCGCAAGTACCCAGGATACCACCGTGGCCCTGAAAGCCCTGAGCGAATTCGCAGCACTGATGAATACCGAACGCACCAATATTCAGGTTACCGTGACCGGCCCGAGTAGCCCGAGCCCTGTGAAATTCCTGATTGATACCCATAATCGTCTGCTGCTGCAGACCGCAGAACTGGCAGTTGTGCAGCCGACCGCCGTTAATATTAGTGCCAATGGCTTCGGCTTCGCAATCTGTCAGCTGAATGTGGTGTATAATGTGAAAGCCAGTGGTAGCAGCCGCCGCCGCCGCAGCATTCAGAATCAGGAAGCATTCGATCTGGATGTGGCCGTTAAAGAAAATAAAGATGATCTGAATCACGTGGATCTGAATGTGTGTACCAGCTTCAGTGGCCCGGGTCGCAGTGGCATGGCACTGATGGAAGTTAATCTGCTGAGCGGCTTCATGGTTCCGAGTGAAGCAATTAGTCTGAGCGAAACCGTGAAAAAAGTTGAATATGATCATGGTAAGCTGAATCTGTATCTGGATAGTGTTAATGAAACACAATTCTGTGTGAATATCCCGGCAGTGCGTAACTTCAAAGTTAGCAATACCCAGGATGCAAGCGTTAGCATTGTGGATTATTATGAACCGCGCCGTCAGGCCGTGCGTAGCTATAATAGCGAAGTGAAACTGAGTAGTTGTGATCTGTGCAGTGATGTGCAGGGTTGTCGTCCGTGCGAAGATGGTGCA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human DENND4C activation kit by CRISPRa
GA110869 1 Kit

Human DENND4C activation kit by CRISPRa

Sign In for Pricing
View Details
(S)-Naproxen Acyl-Beta-D-glucuronide
TRC-N377530-1MG 1 mg

(S)-Naproxen Acyl-Beta-D-glucuronide

Sign In for Pricing
View Details
KCNE1 Rabbit Polyclonal Antibody
TA361882 100 µL

KCNE1 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
HBM (NM_001003938) Human Recombinant Protein
TP307833L 1 mg

HBM (NM_001003938) Human Recombinant Protein

Sign In for Pricing
View Details
Human Protein FAM195A (MCRIP2) activation kit by CRISPRa
GA113523 1 Kit

Human Protein FAM195A (MCRIP2) activation kit by CRISPRa

Sign In for Pricing
View Details
Aflatoxin B2
TRC-A357465-5MG 5 mg

Aflatoxin B2

Sign In for Pricing
View Details