Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

TSTD3 cDNA

TSTD3 contains 1 rhodanese domain that is characterized by an active site cysteine residue that is able to bind sulfane sulfur and catalyse sulfur transfer.

Product Specifications

Chromosomal Location

6q16.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAAAATAGAAAAGTGTGGCTGGTCTGAAGGTTTGACGTCAATAAAGGGAAACTGCCACAATTTTTATACTGCTATTTCTAAAGATGTCACTTATAAGGAACTTAAAAACCTGTTGAATTCTAAAAATATTATGTTAATTGATGTTAGAGAGATATGGGAAATTCTGGAGTATCAAAAAATCCCTGAGTCTATCAATGTACCATTGGATGAAGTAGGTGAAGCTCTACAGATGAATCCAAGAGACTTCAAAGAGAAGTACAATGAAGTAAAACCATCCAAATCTGACAGCTAG

Additionnal Information

TSTD3, TSTD3, ATGD0499-10 µg, ATGD0499-20 µg, ATGD0499-50 µg, ATGD0499-100 µg, ATGD0499-250 µg, ATGD0499-500 µg, ATGD0499-1 mg, ATGD0499-10, ATGD0499-20, ATGD0499-50, ATGD0499-100, ATGD0499-250, ATGD0499-500, ATGD0499-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Other

NCBI Accession Number

NP_001182060.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001195131.1

DNA Size

294bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MASP2 (Mannan-binding Lectin Serine Protease 2, MBL-associated Serine Protease 2, Mannose-binding Protein-associated Serine Protease 2, MASP-2) (MaxLight 490)
129447-ML490 100 µL

MASP2 (Mannan-binding Lectin Serine Protease 2, MBL-associated Serine Protease 2, Mannose-binding Protein-associated Serine Protease 2, MASP-2) (MaxLight 490)

Sign In for Pricing
View Details
1-Naphthylamine pract
114160 500 500 g

1-Naphthylamine pract

Sign In for Pricing
View Details
Rat Lymphocytic Choriomeningitis Virus Antibody (LCMV-Ab) ELISA Kit
EIA07203r 1 Kit

Rat Lymphocytic Choriomeningitis Virus Antibody (LCMV-Ab) ELISA Kit

Sign In for Pricing
View Details
Human NCALD Knockout A549 cell line
GTR15412970 1 Vial

Human NCALD Knockout A549 cell line

Sign In for Pricing
View Details
Recombinant Arabidopsis thaliana Mitochondrial import inner membrane translocase subunit Tim8 (TIM8)
MBS1410958-01 0.02 mg (E-Coli)

Recombinant Arabidopsis thaliana Mitochondrial import inner membrane translocase subunit Tim8 (TIM8)

Sign In for Pricing
View Details
Recombinant Arabidopsis thaliana Mitochondrial import inner membrane translocase subunit Tim8 (TIM8)
MBS1410958-02 0.1 mg (E-Coli)

Recombinant Arabidopsis thaliana Mitochondrial import inner membrane translocase subunit Tim8 (TIM8)

Sign In for Pricing
View Details