Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPS24 cDNA

40S ribosomal protein S24 isoform a, also known as RPS24, belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia.

Product Specifications

Product Name Alternative

DBA3, S24

Chromosomal Location

10q22

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGGAAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGATTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAAAAGACCTCAAGAAAGCAACGAAAGGAACGCAAGAACAGAATGAAGAAAGTCAGGGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGA

Additionnal Information

RPS24, DBA3, S24, RPS24, ATGD0481-10 µg, ATGD0481-20 µg, ATGD0481-50 µg, ATGD0481-100 µg, ATGD0481-250 µg, ATGD0481-500 µg, ATGD0481-1 mg, ATGD0481-10, ATGD0481-20, ATGD0481-50, ATGD0481-100, ATGD0481-250, ATGD0481-500, ATGD0481-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

602412

NCBI Accession Number

NP_148982.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_033022.3

DNA Size

393bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Tceal6 (NM_025355) Mouse Tagged Lenti ORF Clone
MR202020L4 10 µg

Tceal6 (NM_025355) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Recombinant Conus catus Omega-conotoxin CVID
MBS1221272-01 0.05 mg (E-Coli)

Recombinant Conus catus Omega-conotoxin CVID

Sign In for Pricing
View Details
Recombinant Conus catus Omega-conotoxin CVID
MBS1221272-02 0.2 mg (E-Coli)

Recombinant Conus catus Omega-conotoxin CVID

Sign In for Pricing
View Details
Recombinant Conus catus Omega-conotoxin CVID
MBS1221272-03 0.05 mg (Yeast)

Recombinant Conus catus Omega-conotoxin CVID

Sign In for Pricing
View Details
Recombinant Conus catus Omega-conotoxin CVID
MBS1221272-04 0.5 mg (E-Coli)

Recombinant Conus catus Omega-conotoxin CVID

Sign In for Pricing
View Details
Recombinant Conus catus Omega-conotoxin CVID
MBS1221272-05 0.05 mg (Baculovirus)

Recombinant Conus catus Omega-conotoxin CVID

Sign In for Pricing
View Details