Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPL32 cDNA

RPL32 is a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. RPL32 is located in the cytoplasm. Although some studies have mapped this gene to 3q13. 3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for RPL32.

Product Specifications

Product Name Alternative

L32, PP9932

Chromosomal Location

3p25-p24

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGATCGTCAAAAAGAGAACCAAGAAGTTCATCCGGCACCAGTCAGACCGATATGTCAAAATTAAGCGTAACTGGCGGAAACCCAGAGGCATTGACAACAGGGTTCGTAGAAGATTCAAGGGCCAGATCTTGATGCCCAACATTGGTTATGGAAGCAACAAAAAAACAAAGCACATGCTGCCCAGTGGCTTCCGGAAGTTCCTGGTCCACAACGTCAAGGAGCTGGAAGTGCTGCTGATGTGCAACAAATCTTACTGTGCCGAGATCGCTCACAATGTTTCCTCCAAGAACCGCAAAGCCATCGTGGAAAGAGCTGCCCAACTGGCCATCAGAGTCACCAACCCCAATGCCAGGCTGCGCAGTGAAGAAAATGAGTAG

Additionnal Information

RPL32, L32, PP9932, RPL32, ATGD0480-10 µg, ATGD0480-20 µg, ATGD0480-50 µg, ATGD0480-100 µg, ATGD0480-250 µg, ATGD0480-500 µg, ATGD0480-1 mg, ATGD0480-10, ATGD0480-20, ATGD0480-50, ATGD0480-100, ATGD0480-250, ATGD0480-500, ATGD0480-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

NCBI Accession Number

NP_001007075.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001007074.1

DNA Size

408bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Pasteurella Multocida hisA Protein (aa 1-249)
VAng-Cr6867-50gEcoli 50 µg (E. coli)

Recombinant Pasteurella Multocida hisA Protein (aa 1-249)

Sign In for Pricing
View Details
Rat PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) ELISA Kit
ELK9397-01 48 Tests

Rat PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) ELISA Kit

Sign In for Pricing
View Details
Rat PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) ELISA Kit
ELK9397-02 96 Tests

Rat PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) ELISA Kit

Sign In for Pricing
View Details
Rat PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) ELISA Kit
ELK9397-03 5x 96 Tests

Rat PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) ELISA Kit

Sign In for Pricing
View Details
Mrrf 3'UTR Lenti-reporter-Luc Vector
30609084 1.0 µg

Mrrf 3'UTR Lenti-reporter-Luc Vector

Sign In for Pricing
View Details
Anti-SYNPO2 Antibody Picoband® Fluoro594 Conjugated
A07616-1-Fluoro594 100 µg/Vial

Anti-SYNPO2 Antibody Picoband® Fluoro594 Conjugated

Sign In for Pricing
View Details