Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

BUD31 cDNA

BUD31 (BUD31 Homolog (S. Cerevisiae) ) is a nuclear protein that belongs to the BuD31 (G10) family. It contains a putative nuclear translocation sequence, an N-terminal acidic domain and a cysteine-rich C-terminal domain containing a putative Zinc-finger structure. The structure of BuD31 suggests that it may be a nuclear regulator of transcription.

Product Specifications

Product Name Alternative

Cwc14, EDG-2, EDG2, fSAP17, G10, YCR063W

Chromosomal Location

7q22.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGCCTAAAGTCAAAAGAAGCCGGAAAGCACCCCCAGATGGCTGGGAGTTGATTGAGCCAACACTGGATGAATTAGATCAAAAGATGAGAGAAGCTGAAACAGAACCGCATGAGGGAAAGAGGAAAGTGGAATCTCTGTGGCCCATCTTCAGGATCCACCACCAGAAAACCCGCTACATCTTCGACCTCTTTTACAAGCGGAAAGCCATCAGCAGAGAACTCTATGAATATTGTATTAAAGAAGGCTATGCAGACAAAAACCTGATTGCAAAATGGAAAAAGCAAGGATATGAGAACTTGTGCTGCCTGCGGTGCATTCAGACACGGGACACCAACTTCGGGACGAACTGCATCTGCCGCGTGCCCAAAAGCAAGCTGGAAGTGGGCCGCATCATCGAGTGCACACACTGTGGCTGTCGTGGCTGCTCTGGCTGA

Additionnal Information

BUD31, Cwc14, EDG-2, EDG2, fSAP17, G10, YCR063W, BUD31, ATGD0474-10 µg, ATGD0474-20 µg, ATGD0474-50 µg, ATGD0474-100 µg, ATGD0474-250 µg, ATGD0474-500 µg, ATGD0474-1 mg, ATGD0474-10, ATGD0474-20, ATGD0474-50, ATGD0474-100, ATGD0474-250, ATGD0474-500, ATGD0474-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

603477

NCBI Accession Number

NP_003901.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_003910.3

DNA Size

435bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CASP3 (Caspase 3, CPP32, Yama, CPP32B, SCA-1, Caspase-3, APOPAIN) (MaxLight 550)
MBS6409596-01 0.1 mL

CASP3 (Caspase 3, CPP32, Yama, CPP32B, SCA-1, Caspase-3, APOPAIN) (MaxLight 550)

Sign In for Pricing
View Details
CASP3 (Caspase 3, CPP32, Yama, CPP32B, SCA-1, Caspase-3, APOPAIN) (MaxLight 550)
MBS6409596-02 5x 0.1 mL

CASP3 (Caspase 3, CPP32, Yama, CPP32B, SCA-1, Caspase-3, APOPAIN) (MaxLight 550)

Sign In for Pricing
View Details
ITGB1BP3 Human
OM304914-01 2 µg

ITGB1BP3 Human

Sign In for Pricing
View Details
ITGB1BP3 Human
OM304914-02 10 µg

ITGB1BP3 Human

Sign In for Pricing
View Details
ITGB1BP3 Human
OM304914-03 100 µg

ITGB1BP3 Human

Sign In for Pricing
View Details
Lentiviral mouse Lkaaear1 shRNA (UAS) - Lentiviral mouse Lkaaear1 shRNA (UAS, RFP) (100)
GTR15269016 1 Vial

Lentiviral mouse Lkaaear1 shRNA (UAS) - Lentiviral mouse Lkaaear1 shRNA (UAS, RFP) (100)

Sign In for Pricing
View Details