Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPS15 cDNA

RPS15 is a ribosomal protein that is a component of the 40S subunit. It belongs to the S19P family of ribosomal proteins. RPS15 is located in the cytoplasm. RPS15 has been found to be activated in various tumors, such as insulinomas, esophageal cancers, and colon cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of RPS15 dispersed through the genome.

Product Specifications

Product Name Alternative

RIG, S15

Chromosomal Location

19p13.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTCACCTACCGCGGCGTGGACCTCGACCAGCTGCTGGACATGTCCTACGAGCAGCTGATGCAGCTGTACAGTGCGCGCCAGCGGCGGCGGCTGAACCGGGGCCTGCGGCGGAAGCAGCACTCCCTGCTGAAGCGCCTGCGCAAGGCCAAGAAGGAGGCGCCGCCCATGGAGAAGCCGGAAGTGGTGAAGACGCACCTGCGGGACATGATCATCCTACCCGAGATGGTGGGCAGCATGGTGGGCGTCTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAGCCCGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAGCCCGTAAAGCATGGCCGGCCCGGCATCGGGGCCACCCACTCCTCCCGCTTCATCCCTCTCAAGTAA

Additionnal Information

RPS15, RIG, S15, RPS15, ATGD0473-10 µg, ATGD0473-20 µg, ATGD0473-50 µg, ATGD0473-100 µg, ATGD0473-250 µg, ATGD0473-500 µg, ATGD0473-1 mg, ATGD0473-10, ATGD0473-20, ATGD0473-50, ATGD0473-100, ATGD0473-250, ATGD0473-500, ATGD0473-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

180535

NCBI Accession Number

NP_001009.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001018.4

DNA Size

438bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

RXR beta Rabbit Polyclonal Antibody (FITC)
orb103427 100 µL

RXR beta Rabbit Polyclonal Antibody (FITC)

Sign In for Pricing
View Details
Anti-CTSS antibody
STJ115443 100 µl

Anti-CTSS antibody

Sign In for Pricing
View Details
ARP33463_P050-25UL - TSG101 Antibody - N-terminal region
ARP33463_P050-25UL 25 µL

ARP33463_P050-25UL - TSG101 Antibody - N-terminal region

Sign In for Pricing
View Details
Rabbit Anti Human DLL4 Polyclonal Affinity Purified (PBS with 0.05% sodium azide and 50% glycerol, pH7.4) (IHC,ELISA) 200UL
IRBAMLDLL4AP55200UL 200 µL

Rabbit Anti Human DLL4 Polyclonal Affinity Purified (PBS with 0.05% sodium azide and 50% glycerol, pH7.4) (IHC,ELISA) 200UL

Sign In for Pricing
View Details
Chicken Cytoskeleton-associated protein 4 (CKAP4) ELISA Kit
MBS7238594-01 48 Well

Chicken Cytoskeleton-associated protein 4 (CKAP4) ELISA Kit

Sign In for Pricing
View Details
Chicken Cytoskeleton-associated protein 4 (CKAP4) ELISA Kit
MBS7238594-02 96 Well

Chicken Cytoskeleton-associated protein 4 (CKAP4) ELISA Kit

Sign In for Pricing
View Details