Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPS19 cDNA

RPS19 is a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S19E family of ribosomal proteins. It is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia (DBA), a constitutional erythroblastopenia characterized by absent or decreased erythroid precursors, in a subset of patients.

Product Specifications

Product Name Alternative

DBA, DBA1, S19

Chromosomal Location

19q13.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGCCTGGAGTTACTGTAAAAGACGTGAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGATACCGTCAAGCTGGCCAAGCACAAAGAGCTTGCTCCCTACGATGAGAACTGGTTCTACACGCGAGCTGCTTCCACAGCGCGGCACCTGTACCTCCGGGGTGGCGCTGGGGTTGGCTCCATGACCAAGATCTATGGGGGACGTCAGAGAAACGGCGTCATGCCCAGCCACTTCAGCCGAGGCTCCAAGAGTGTGGCCCGCCGGGTCCTCCAAGCCCTGGAGGGGCTGAAAATGGTGGAAAAGGACCAAGATGGCGGCCGCAAACTGACACCTCAGGGACAAAGAGATCTGGACAGAATCGCCGGACAGGTGGCAGCTGCCAACAAGAAGCATTAG

Additionnal Information

RPS19, DBA, DBA1, S19, RPS19, ATGD0472-10 µg, ATGD0472-20 µg, ATGD0472-50 µg, ATGD0472-100 µg, ATGD0472-250 µg, ATGD0472-500 µg, ATGD0472-1 mg, ATGD0472-10, ATGD0472-20, ATGD0472-50, ATGD0472-100, ATGD0472-250, ATGD0472-500, ATGD0472-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

603474

NCBI Accession Number

NP_001013.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001022.3

DNA Size

438bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Monoclonal STING/TMEM173 Antibody (STING1/8187R) [Alexa Fluor 750]
NBP3-20699AF750 0.1 mL

Rabbit Monoclonal STING/TMEM173 Antibody (STING1/8187R) [Alexa Fluor 750]

Sign In for Pricing
View Details
Bone Tissue Genomic Nucleic Acid (DNA/RNA) Extraction Kit
MBS4504184 25 Tests

Bone Tissue Genomic Nucleic Acid (DNA/RNA) Extraction Kit

Sign In for Pricing
View Details
ZNF265 Colorimetric Cell-Based ELISA
EKC1659 1 Kit, containing one 96 Well Plate and all necessary reagents

ZNF265 Colorimetric Cell-Based ELISA

Sign In for Pricing
View Details
Rat Transmembrane protein 194B (TMEM194B) ELISA kit
GTR10376627 96 Well

Rat Transmembrane protein 194B (TMEM194B) ELISA kit

Sign In for Pricing
View Details
Mouse Monoclonal MTFMT Antibody (OTI2A2) [DyLight 405]
NBP2-72803V 0.1 mL

Mouse Monoclonal MTFMT Antibody (OTI2A2) [DyLight 405]

Sign In for Pricing
View Details
Mouse Transmembrane protein 203 (TMEM203) ELISA Kit
abx550096 96 Tests

Mouse Transmembrane protein 203 (TMEM203) ELISA Kit

Sign In for Pricing
View Details