Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ZWINT cDNA

ZWINT is involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. Alternatively spliced transcript variants encoding different isoforms have been found for this gene

Product Specifications

Product Name Alternative

HZwint-1, KNTC2AP, SIP30, ZWINT1

Chromosomal Location

10q21-q22

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAGAGGTCCTGGCTGAGGTGGCAGGCATCTTGGAACCTGTAGGCCTGCAGGAGGAGGCAGAACTGCCAGCCAAGATCCTGGTTGAGTTTGTGGTGGACTCTCAGAAGAAAGACAAGCTGCTCTGCAGCCAGCTTCAGGTAGCGGATTTCCTGCAGAACATCCTGGCTCAGGAGGACACTGCTAAGGGTCTCGACCCCTTGGCTTCTGAAGACACGAGCCGACAGAAGGCAATTGCAGCTAAGGAACAATGGAAAGAGCTGAAGGCCACCTACAGGGAGCACGTAGAGGCCATCAAAATTGGCCTCACCAAGGCCCTGACTCAGATGGAGGAAGCCCAGAGGAAACGGACACAACTCCGGGAAGCCTTTGAGCAGCTCCAGGCCAAGAAACAAATGGCCATGGAGAAACGCAGAGCAGTCCAGAACCAGTGGCAGCTACAACAGGAGAAGCATCTGCAGCATCTGGCGGAGGTTTCTGCAGAGGGTAAGCTGTTGTTCCCTGAGGCTGAGGCTGAGGCAGAGAATCTTCCAGATGATAAACCCCAGCAGCCGACTCGACCCCAGGAGCAGAGTACAGGAGACACCATGGGGAGAGACCCTGGTGTGTCCTTCAAGGCTGTTGGTCTACAACCTGCTGGAGATGTAAATTTGCCATGA

Additionnal Information

ZWINT, HZwint-1, KNTC2AP, SIP30, ZWINT1, ZWINT, ATGD0463-10 µg, ATGD0463-20 µg, ATGD0463-50 µg, ATGD0463-100 µg, ATGD0463-250 µg, ATGD0463-500 µg, ATGD0463-1 mg, ATGD0463-10, ATGD0463-20, ATGD0463-50, ATGD0463-100, ATGD0463-250, ATGD0463-500, ATGD0463-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cell Cycle

Omim

609177

NCBI Accession Number

NP_001005413.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001005413.1

DNA Size

693bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

TRNAE39P sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2485807 1.0 µg DNA

TRNAE39P sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
OR4F4 (NM_001004195) Human Tagged ORF Clone Lentiviral Particle
RC212573L3V 200 µL

OR4F4 (NM_001004195) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
TUBA8 Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2C2]
TA501123BM 100 µL

TUBA8 Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2C2]

Sign In for Pricing
View Details
Gdf11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3729302 1.0 µg DNA

Gdf11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
Lentiviral mouse Fbxo42 shRNA (UAS) - Lentiviral mouseFbxo42 shRNA (UAS, GFP) (25)
GTR15280256 1 Vial

Lentiviral mouse Fbxo42 shRNA (UAS) - Lentiviral mouseFbxo42 shRNA (UAS, GFP) (25)

Sign In for Pricing
View Details
Crh Mouse Gene Knockout Kit (CRISPR)
KN503821 1 Kit

Crh Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details