Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RFXANK cDNA

RFXANK, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain It contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Two transcript variants encoding different isoforms have been described for this gene, with only one isoform showing activation activity.

Product Specifications

Product Name Alternative

ANKRA1, BLS, F14150_1, RFX-B

Chromosomal Location

19p12

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGAGCTTACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGACCCTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTTTCCCTGCACCCCTGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGGCAGCTCCCTGAAGCACTCCACCACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGCTCTGCCGGCCACCCTAGACTGTGACAACCTCGTCAACAAGCCAGACGAGCGCGGCTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAGACCGTTCGCTTCCTGCTGGAGTGGGGTGCCGACCCCCACATCCTGGCAAAAGAGCGAGAGAGCGCCCTGTCGCTGGCCAGCACAGGCGGCTACACAGACATTGTGGGGCTGCTGCTGGAGCGTGACGTGGACATCAACATCTATGATTGGAATGGAGGGACGCCACTGCTGTACGCTGTGCGCGGGAACCACGTGAAATGCGTTGAGGCCTTGCTGGCCCGAGGCGCTGACCTCACCACCGAAGCCGACTCTGGCTACACCCCGATGGACCTTGCCGTGGCCCTGGGATACCGGAAAGTGCAACAGGTGATCGAGAACCACATCCTCAAGCTCTTCCAGAGCAACCTGGTGCCCGCTGACCCTGAGTGA

Additionnal Information

RFXANK, ANKRA1, BLS, F14150_1, RFX-B, RFXANK, ATGD0462-10 µg, ATGD0462-20 µg, ATGD0462-50 µg, ATGD0462-100 µg, ATGD0462-250 µg, ATGD0462-500 µg, ATGD0462-1 mg, ATGD0462-10, ATGD0462-20, ATGD0462-50, ATGD0462-100, ATGD0462-250, ATGD0462-500, ATGD0462-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Immunology

Omim

603200

NCBI Accession Number

NP_604389.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_134440.1

DNA Size

714bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

RHBDD3 Human Pre-designed siRNA Set A
HY-RS11933 1 Set

RHBDD3 Human Pre-designed siRNA Set A

Sign In for Pricing
View Details
USP28 Protein Vector (Mouse) (pPM-C-His)
PV244533 500 ng

USP28 Protein Vector (Mouse) (pPM-C-His)

Sign In for Pricing
View Details
FAIM1 Immunizing Peptide
orb16905 100 µg

FAIM1 Immunizing Peptide

Sign In for Pricing
View Details
Human C1orf56 activation kit by CRISPRa
GA110410 1 Kit

Human C1orf56 activation kit by CRISPRa

Sign In for Pricing
View Details
Mrpl54 Antibody
orb861040 2 mg

Mrpl54 Antibody

Sign In for Pricing
View Details
Setd1a-set siRNA/shRNA/RNAi Lentivector (Mouse)
43520094 4x 500 ng

Setd1a-set siRNA/shRNA/RNAi Lentivector (Mouse)

Sign In for Pricing
View Details