Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CHCHD3 cDNA

CHCHD3 (Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3) is required for maintenance of mitochondrial crista integrity and mitochondrial function. It may act as a scaffolding protein that stabilizes protein complexes involved in crista architecture and protein import. It has also been shown to function as a transcription factor which binds to the BAG1 promoter and represses BAG1 transcription.

Product Specifications

Product Name Alternative

Mic19, MINOS3, PPP1R22

Chromosomal Location

7q33

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTCGGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCCGAAGATCAGAAACGACTAAAGCAAGCCAAAGAGCTGGACCGAGAGAGGGCTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATGTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGGCTAGGCAGCTGGAAGAGAAAGACCGAGTGCTAAAGAAGCAGGATGCATTCTACAAAGAACAGCTGGCTAGACTGGAGGAGAGGAGCTCAGAGTTCTACAGAGTCACCACTGAACAATATCAGAAAGCTGCTGAAGAGGTGGAAGCAAAGTTCAAGCGATATGAGTCTCATCCAGTCTGTGCTGATCTGCAGGCCAAAATTCTTCAGTGTTACCGTGAGAACACCCACCAGACCCTCAAATGCTCCGCTCTGGCCACCCAGTATATGCACTGTGTCAATCATGCCAAACAGAGCATGCTTGAGAAGGGAGGATAA

Additionnal Information

CHCHD3, Mic19, MINOS3, PPP1R22, CHCHD3, ATGD0457-10 µg, ATGD0457-20 µg, ATGD0457-50 µg, ATGD0457-100 µg, ATGD0457-250 µg, ATGD0457-500 µg, ATGD0457-1 mg, ATGD0457-10, ATGD0457-20, ATGD0457-50, ATGD0457-100, ATGD0457-250, ATGD0457-500, ATGD0457-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Metabolism

Omim

613748

NCBI Accession Number

NP_060282.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_017812.2

DNA Size

684bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

PYROXD1 Polyclonal Antibody
MBS9237449-01 0.1 mL

PYROXD1 Polyclonal Antibody

Sign In for Pricing
View Details
PYROXD1 Polyclonal Antibody
MBS9237449-02 5x 0.1 mL

PYROXD1 Polyclonal Antibody

Sign In for Pricing
View Details
MYCBP2 Polyclonal Antibody, AbBy Fluor™ 647 Conjugated
bs-9375R-BF647-TR 20 µL

MYCBP2 Polyclonal Antibody, AbBy Fluor™ 647 Conjugated

Sign In for Pricing
View Details
Neuroendocrine Convertase 1 (PCSK1) Antibody
abx126335-01 20 µL

Neuroendocrine Convertase 1 (PCSK1) Antibody

Sign In for Pricing
View Details
Neuroendocrine Convertase 1 (PCSK1) Antibody
abx126335-02 100 µL

Neuroendocrine Convertase 1 (PCSK1) Antibody

Sign In for Pricing
View Details
Neuroendocrine Convertase 1 (PCSK1) Antibody
abx126335-03 2x 100 µL

Neuroendocrine Convertase 1 (PCSK1) Antibody

Sign In for Pricing
View Details