Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RDM1 cDNA

RDM1 is involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. This protein contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. Alternatively spliced transcript variants encoding different isoforms have been reported

Product Specifications

Product Name Alternative

RAD52B

Chromosomal Location

17q11.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGGAGTTGGTACCTTTTGCGGTTCCCATCGAGAGTGACAAAACCTTGCTAGTGTGGGAGCTGAGCTCCGGACCCACGGCCGAGGCTTTGCATCATTCTCTGTTCACAGCATTTTCTCAGTTTGGCCTTCTGTATTCAGTCCGGGTCTTCCCAAATGCTGCAGTGGCCCATCCTGGTTTCTATGCCGTCATTAAGTTTTATTCTGCAAGGGCTGCCCACAGAGCCCAAAAGGCATGCGACCGGAAGCAGCTTTTTCAGAAATCTCCAGTCAAGGTTCGTCTTGGCACCAGACATAAGGCAGTTCAACATCAAGCCCTTGCCCTGAACAGTTCCAAATGCCAAGAACTGGCGAATTACTACTTTGGTTTCAATGGGTGTTCCAAAAGGATCATCAAGCTTCAGGAGCTTTCTGACCTTGAAGAAAGGGAAAATGAAGATAGCATGGTGCCACTTCCGAAGCAAAGCCTGAAGTTCTTCTGTGCTTTAGAAGTGGTGTTGCCATCCTGTGATTGCAGGAGTCCTGGCATTGGCTTGGTGGAGGAGCCTATGGATAAGGTGGAGGAAGGACCATTATCATTCCTTATGAAAAGGAAGACAGCCCAGAAGCTTGCTATTCAGAAGGCTTTGTCAGATGCATTCCAGAAACTGTTGATTGTTGTTCTAGAAAGTGGTAAAATAGCTGTGGAGTACAGACCCAGTGAAGACATCGTAGGTGTCAGATGCGAAGAAGAACTACACGGTTTAATTCAAGTCCCTTGCTCTCCCTGGAAGCAGTATGGCCAAGAGGAGGAAGGGTATCTCTCGGATTTCAGCTTGGAGGAGGAAGAGTTCAGGCTGCCAGAACTTGACTAG

Additionnal Information

RDM1, RAD52B, RDM1, ATGD0454-10 µg, ATGD0454-20 µg, ATGD0454-50 µg, ATGD0454-100 µg, ATGD0454-250 µg, ATGD0454-500 µg, ATGD0454-1 mg, ATGD0454-10, ATGD0454-20, ATGD0454-50, ATGD0454-100, ATGD0454-250, ATGD0454-500, ATGD0454-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

612896

NCBI Accession Number

NP_663629.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_145654.3

DNA Size

855bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Zcchc2 Rat shRNA Plasmid (Locus ID 304695)
TR708281 1 Kit

Zcchc2 Rat shRNA Plasmid (Locus ID 304695)

Sign In for Pricing
View Details
SNAPIN (NM_012437) Human 3' UTR Clone
SC207508 10 µg

SNAPIN (NM_012437) Human 3' UTR Clone

Sign In for Pricing
View Details
PT 1
sc-361299 10 mg

PT 1

Sign In for Pricing
View Details
Triglyceride Fluorometric Assay Kit
MBS2571977-01 48 Tests

Triglyceride Fluorometric Assay Kit

Sign In for Pricing
View Details
Triglyceride Fluorometric Assay Kit
MBS2571977-02 96 Tests

Triglyceride Fluorometric Assay Kit

Sign In for Pricing
View Details
Triglyceride Fluorometric Assay Kit
MBS2571977-03 5x 96 Tests

Triglyceride Fluorometric Assay Kit

Sign In for Pricing
View Details