Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

Mug cDNA

G/u mismatch-specific DNA glycosylase, xanthine DNA glycosylase, also known as mug, belongs to the TDG/mug DNA glycosylase family. It has been proposed that the Mug protein excises 3, N4-ethenocytosine and removes the uracil base from mismatches in the order of u:G>u:A, although the biological role remains unclear.

Product Specifications

Product Name Alternative

Dug, ECK3058, JW3040, ygjF

Antigen Species

E.coli

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGTTGAGGATATTTTGGCTCCAGGGTTACGGGTCGTGTTTTGCGGTATCAACCCTGGGCTTTCATCCGCCGGGACTGGTTTTCCCTTTGCTCATCCGGCAAATCGCTTCTGGAAGGTGATATATCAGGCCGGGTTTACCGACCGTCAGTTGAAGCCGCAGGAGGCACAGCATCTGCTGGATTATCGTTGTGGCGTCACCAAACTGGTAGACCGTCCAACGGTGCAAGCCAATGAAGTTTCAAAGCAGGAGCTACACGCAGGCGGGCGTAAGCTGATTGAAAAAATTGAAGATTATCAGCCGCAGGCGTTGGCGATTCTGGGCAAACAAGCATATGAACAGGGATTCAGCCAGCGCGGTGCACAGTGGGGGAAACAAACGCTCACCATTGGTTCGACGCAGATTTGGGTGCTGCCAAATCCCAGCGGTTTAAGTCGCGTTTCACTGGAGAAACTGGTTGAAGCGTATCGCGAGCTGGACCAGGCGCTGGTAGTGCGTGGGCGATAA

Additionnal Information

Mug, dug, ECK3058, JW3040, ygjF, mug, ATGD0438-10 µg, ATGD0438-20 µg, ATGD0438-50 µg, ATGD0438-100 µg, ATGD0438-250 µg, ATGD0438-500 µg, ATGD0438-1 mg, ATGD0438-10, ATGD0438-20, ATGD0438-50, ATGD0438-100, ATGD0438-250, ATGD0438-500, ATGD0438-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Enzymes & Proteases

NCBI Accession Number

NP_417540.1

Species

E.coli

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NC_000913.2

DNA Size

507bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Monoclonal Stathmin 1 Antibody (STMN1/8439) [Alexa Fluor 750]
NBP3-26963AF750 0.1 mL

Mouse Monoclonal Stathmin 1 Antibody (STMN1/8439) [Alexa Fluor 750]

Sign In for Pricing
View Details
INOS Antibody [G10L10]
C21401-20uL 20 µL

INOS Antibody [G10L10]

Sign In for Pricing
View Details
SMIM1 Antibody, Biotin conjugated
A52338-100UG 100 µg

SMIM1 Antibody, Biotin conjugated

Sign In for Pricing
View Details
TDRD3 siRNA (Mouse)
CRN2275-01 15 nmol

TDRD3 siRNA (Mouse)

Sign In for Pricing
View Details
TDRD3 siRNA (Mouse)
CRN2275-02 30 nmol

TDRD3 siRNA (Mouse)

Sign In for Pricing
View Details
C1qtnf7 (NM_001107221) Rat Untagged Clone
RN210324 10 µg

C1qtnf7 (NM_001107221) Rat Untagged Clone

Sign In for Pricing
View Details