Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

Mug cDNA

G/u mismatch-specific DNA glycosylase, xanthine DNA glycosylase, also known as mug, belongs to the TDG/mug DNA glycosylase family. It has been proposed that the Mug protein excises 3, N4-ethenocytosine and removes the uracil base from mismatches in the order of u:G>u:A, although the biological role remains unclear.

Product Specifications

Product Name Alternative

Dug, ECK3058, JW3040, ygjF

Antigen Species

E.coli

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGTTGAGGATATTTTGGCTCCAGGGTTACGGGTCGTGTTTTGCGGTATCAACCCTGGGCTTTCATCCGCCGGGACTGGTTTTCCCTTTGCTCATCCGGCAAATCGCTTCTGGAAGGTGATATATCAGGCCGGGTTTACCGACCGTCAGTTGAAGCCGCAGGAGGCACAGCATCTGCTGGATTATCGTTGTGGCGTCACCAAACTGGTAGACCGTCCAACGGTGCAAGCCAATGAAGTTTCAAAGCAGGAGCTACACGCAGGCGGGCGTAAGCTGATTGAAAAAATTGAAGATTATCAGCCGCAGGCGTTGGCGATTCTGGGCAAACAAGCATATGAACAGGGATTCAGCCAGCGCGGTGCACAGTGGGGGAAACAAACGCTCACCATTGGTTCGACGCAGATTTGGGTGCTGCCAAATCCCAGCGGTTTAAGTCGCGTTTCACTGGAGAAACTGGTTGAAGCGTATCGCGAGCTGGACCAGGCGCTGGTAGTGCGTGGGCGATAA

Additionnal Information

Mug, dug, ECK3058, JW3040, ygjF, mug, ATGD0438-10 µg, ATGD0438-20 µg, ATGD0438-50 µg, ATGD0438-100 µg, ATGD0438-250 µg, ATGD0438-500 µg, ATGD0438-1 mg, ATGD0438-10, ATGD0438-20, ATGD0438-50, ATGD0438-100, ATGD0438-250, ATGD0438-500, ATGD0438-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Enzymes & Proteases

NCBI Accession Number

NP_417540.1

Species

E.coli

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NC_000913.2

DNA Size

507bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

HSPD1P14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1001906 1.0 µg DNA

HSPD1P14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
SLC6A19 Polyclonal Antibody
RD79717A-01 20 µL

SLC6A19 Polyclonal Antibody

Sign In for Pricing
View Details
SLC6A19 Polyclonal Antibody
RD79717A-02 60 μL

SLC6A19 Polyclonal Antibody

Sign In for Pricing
View Details
SLC6A19 Polyclonal Antibody
RD79717A-03 120 μL

SLC6A19 Polyclonal Antibody

Sign In for Pricing
View Details
SLC6A19 Polyclonal Antibody
RD79717A-04 200 µL

SLC6A19 Polyclonal Antibody

Sign In for Pricing
View Details
ALPL Antibody / Alkaline Phosphatase (tissue-nonspecific)
V7411-20UG 20 µg

ALPL Antibody / Alkaline Phosphatase (tissue-nonspecific)

Sign In for Pricing
View Details