Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SPA17 cDNA

SPA17 encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. A retrotransposed pseudogene is present on chromosome 10q22.

Product Specifications

Product Name Alternative

CT22, SP17, SP17-1

Chromosomal Location

11q24.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCGATTCCATTCTCCAACACCCACTACCGAATTCCACAAGGATTTGGGAATCTTCTTGAAGGGCTGACACGCGAGATTCTGAGAGAGCAACCGGACAATATACCAGCTTTTGCAGCAGCCTATTTTGAGAGCCTTCTAGAGAAAAGAGAGAAAACCAACTTTGATCCAGCAGAATGGGGGAGTAAGGTAGAAGACCGCTTCTATAACAATCATGCATTCGAGGAGCAAGAACCACCTGAGAAAAGTGATCCTAAACAAGAAGAGTCTCAGATATCTGGGAAGGAGGAAGAGACATCAGTCACCATCTTAGACTCTTCTGAGGAAGATAAGGAAAAAGAAGAGGTTGCTGCTGTCAAAATCCAAGCTGCCTTCCGGGGACACATAGCCAGAGAGGAGGCAAAGAAAATGAAAACAAATAGTCTTCAAAATGAGGAAAAAGAGGAAAACAAGTGA

Additionnal Information

SPA17, CT22, SP17, SP17-1, SPA17, ATGD0437-10 µg, ATGD0437-20 µg, ATGD0437-50 µg, ATGD0437-100 µg, ATGD0437-250 µg, ATGD0437-500 µg, ATGD0437-1 mg, ATGD0437-10, ATGD0437-20, ATGD0437-50, ATGD0437-100, ATGD0437-250, ATGD0437-500, ATGD0437-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cancer

Omim

608621

NCBI Accession Number

NP_059121.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_017425.3

DNA Size

456bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PTPRN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1758602 1.0 µg DNA

PTPRN2 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
STMN2 (Stathmin-like 2, SCG10, SCGN10, SGC10) (MaxLight 750)
MBS6237001-01 0.1 mL

STMN2 (Stathmin-like 2, SCG10, SCGN10, SGC10) (MaxLight 750)

Sign In for Pricing
View Details
STMN2 (Stathmin-like 2, SCG10, SCGN10, SGC10) (MaxLight 750)
MBS6237001-02 5x 0.1 mL

STMN2 (Stathmin-like 2, SCG10, SCGN10, SGC10) (MaxLight 750)

Sign In for Pricing
View Details
Tescl Mouse shRNA Lentiviral Particle (Locus ID 69301)
TL509552V 500 µL Each

Tescl Mouse shRNA Lentiviral Particle (Locus ID 69301)

Sign In for Pricing
View Details
Acpp sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4950008 1.0 µg DNA

Acpp sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
STAT1 Mouse Monoclonal Antibody (HRP)
orb2609735 100 µg

STAT1 Mouse Monoclonal Antibody (HRP)

Sign In for Pricing
View Details