Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CSDC2 cDNA

CSDC2 (Cold Shock Domain Containing C2, RNA Binding) binds specifically to the very 3-UTR ends of both histone H1 and H3. 3 mRNAs, encompassing the polyadenylation signal. It might play a central role in the negative regulation of histone variant synthesis in the developing brain

Product Specifications

Product Name Alternative

DJ347H13.2, PIPPIN

Chromosomal Location

22q13.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGACTTCAGAGTCGACGTCACCCCCAGTTGTGCCCCCGCTCCACTCCCCCAAGTCCCCAGTCTGGCCCACCTTCCCCTTCCACAGGGAGGGCAGCAGGGTCTGGGAGCGGGGTGGTGTCCCACCTCGGGACCTACCCAGCCCTCTGCCCACCAAGCGGACCAGGACCTATTCAGCGACAGCCCGGGCCTCAGCTGGCCCCGTGTTCAAGGGCGTCTGTAAGCAGTTCTCACGCTCACAGGGCCATGGCTTCATCACCCCCGAGAACGGGTCCGAGGACATCTTCGTACATGTGTCTGACATCGAGGGGGAGTACGTGCCAGTGGAGGGCGACGAGGTGACCTACAAGATGTGCCCTATCCCTCCCAAGAACCAGAAGTTCCAGGCCGTGGAGGTGGTGCTCACTCAGCTGGCCCCCCACACTCCCCACGAGACGTGGTCTGGCCAGGTCGTGGGCTCCTAG

Additionnal Information

CSDC2, dJ347H13.2, PIPPIN, CSDC2, ATGD0433-10 µg, ATGD0433-20 µg, ATGD0433-50 µg, ATGD0433-100 µg, ATGD0433-250 µg, ATGD0433-500 µg, ATGD0433-1 mg, ATGD0433-10, ATGD0433-20, ATGD0433-50, ATGD0433-100, ATGD0433-250, ATGD0433-500, ATGD0433-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

NCBI Accession Number

NP_055275.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_014460.3

DNA Size

462bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CRIM1 (Cysteine-rich Motor Neuron 1 Protein, CRIM-1, Cysteine-rich Repeat-containing Protein S52, S52, UNQ1886/PRO4330, MGC138194) (FITC)
MBS6146659-01 0.1 mL

CRIM1 (Cysteine-rich Motor Neuron 1 Protein, CRIM-1, Cysteine-rich Repeat-containing Protein S52, S52, UNQ1886/PRO4330, MGC138194) (FITC)

Sign In for Pricing
View Details
CRIM1 (Cysteine-rich Motor Neuron 1 Protein, CRIM-1, Cysteine-rich Repeat-containing Protein S52, S52, UNQ1886/PRO4330, MGC138194) (FITC)
MBS6146659-02 5x 0.1 mL

CRIM1 (Cysteine-rich Motor Neuron 1 Protein, CRIM-1, Cysteine-rich Repeat-containing Protein S52, S52, UNQ1886/PRO4330, MGC138194) (FITC)

Sign In for Pricing
View Details
3-Sulfopropane-1-sulfonyl fluoride
DXC57116-01 50 mg

3-Sulfopropane-1-sulfonyl fluoride

Sign In for Pricing
View Details
3-Sulfopropane-1-sulfonyl fluoride
DXC57116-02 0.5 g

3-Sulfopropane-1-sulfonyl fluoride

Sign In for Pricing
View Details
2,5-Dimethylbenzoic Acid
010262 5 g

2,5-Dimethylbenzoic Acid

Sign In for Pricing
View Details
Anti-PGP Antibody Picoband® (Biotine Conjugate)
A00932-1-Biotin 100 µg/Vial

Anti-PGP Antibody Picoband® (Biotine Conjugate)

Sign In for Pricing
View Details