Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

OCIAD2 cDNA

OCIAD2 is a protein that localizes to endosomes and contains one OCIA (Ovarian carcinoma immunoreactive antigen) domain. Diseases associated with OCIAD2 include ovarian mucinous neoplasm. An important paralog of this gene is OCIAD1.

Product Specifications

Chromosomal Location

4p11

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCTTCAGCGTCTGCTCGTGGAAACCAAGATAAAGATGCCCATTTTCCACCACCAAGCAAGCAGAGCCTGTTGTTTTGTCCAAAATCAAAACTGCACATCCACAGAGCAGAGATCTCAAAGATTATGCGAGAATGTCAGGAAGAAAGTTTCTGGAAGAGAGCTCTGCCTTTTTCTCTTGTAAGCATGCTTGTCACCCAGGGACTAGTCTACCAAGGTTATTTGGCAGCTAATTCTAGATTTGGATCATTGCCCAAAGTTGCACTTGCTGGTCTCTTGGGATTTGGCCTTGGAAAGGTATCATACATAGGAGTATGCCAGAGTAAATTCCATTTTTTTGAAGATCAGCTCCGTGGGGCTGGTTTTGGTCCACAGCATAACAGGCACTGCCTCCTTACCTGTGAGGAATGCAAAATAAAGCATGGATTAAGTGAGAAGGGAGACTCTCAGCCTTCAGCTTCCTAA

Additionnal Information

OCIAD2, OCIAD2, ATGD0432-10 µg, ATGD0432-20 µg, ATGD0432-50 µg, ATGD0432-100 µg, ATGD0432-250 µg, ATGD0432-500 µg, ATGD0432-1 mg, ATGD0432-10, ATGD0432-20, ATGD0432-50, ATGD0432-100, ATGD0432-250, ATGD0432-500, ATGD0432-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cancer

NCBI Accession Number

NP_001014446.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001014446.1

DNA Size

465bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

3450-L Die-cut & Printed Numbers & Letters
034522 150 Pack (6 Label (s) x 25 Card)

3450-L Die-cut & Printed Numbers & Letters

Sign In for Pricing
View Details
3-Chloro-4',5-difluorobenzhydrol
PC2583 1 Each

3-Chloro-4',5-difluorobenzhydrol

Sign In for Pricing
View Details
PUS3, NT (PUS3, tRNA pseudouridine(38/39) synthase, tRNA pseudouridine synthase 3, tRNA pseudouridylate synthase 3, tRNA-uridine isomerase 3) (APC)
MBS6339207-01 0.2 mL

PUS3, NT (PUS3, tRNA pseudouridine(38/39) synthase, tRNA pseudouridine synthase 3, tRNA pseudouridylate synthase 3, tRNA-uridine isomerase 3) (APC)

Sign In for Pricing
View Details
PUS3, NT (PUS3, tRNA pseudouridine(38/39) synthase, tRNA pseudouridine synthase 3, tRNA pseudouridylate synthase 3, tRNA-uridine isomerase 3) (APC)
MBS6339207-02 5x 0.2 mL

PUS3, NT (PUS3, tRNA pseudouridine(38/39) synthase, tRNA pseudouridine synthase 3, tRNA pseudouridylate synthase 3, tRNA-uridine isomerase 3) (APC)

Sign In for Pricing
View Details
EIF4G2 Antibody-N-terminal region
MBS3249869-01 0.1 mL

EIF4G2 Antibody-N-terminal region

Sign In for Pricing
View Details
EIF4G2 Antibody-N-terminal region
MBS3249869-02 5x 0.1 mL

EIF4G2 Antibody-N-terminal region

Sign In for Pricing
View Details