Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CAV2 cDNA

CAV2 belongs to the caveolin family and may act as a scaffolding protein within caveolar membranes. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell.

Product Specifications

Product Name Alternative

CAV, Caveolin 2

Chromosomal Location

7q31.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGGCTGGAGACGGAGAAGGCGGACGTACAGCTCTTCATGGACGACGACTCCTACAGCCACCACAGCGGCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCGGACCAGGACCGGGATCCCCACCGGCTCAACTCGCATCTCAAGCTGGGCTTCGAGGATGTGATCGCAGAGCCGGTGACTACGCACTCCTTTGACAAAGTGTGGATCTGCAGCCATGCCCTCTTTGAAATCAGCAAATACGTAATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCCACCCTCAGCTGTCTGCACATCTGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCAGTGCAGACAATATGGAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGCTTCTCTTCTGTCAGCCTGCAACTGAGCCAGGATTGA

Additionnal Information

CAV2, CAV, CAV2, ATGD0425-10 µg, ATGD0425-20 µg, ATGD0425-50 µg, ATGD0425-100 µg, ATGD0425-250 µg, ATGD0425-500 µg, ATGD0425-1 mg, ATGD0425-10, ATGD0425-20, ATGD0425-50, ATGD0425-100, ATGD0425-250, ATGD0425-500, ATGD0425-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Tags & Cell Markers

Omim

601048

NCBI Accession Number

NP_001224.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001233.4

DNA Size

489bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human CDw210a/IL10RA Protein, N-His
orb3061107-01 50 µg

Recombinant Human CDw210a/IL10RA Protein, N-His

Sign In for Pricing
View Details
Recombinant Human CDw210a/IL10RA Protein, N-His
orb3061107-02 100 µg

Recombinant Human CDw210a/IL10RA Protein, N-His

Sign In for Pricing
View Details
Recombinant Human CDw210a/IL10RA Protein, N-His
orb3061107-03 1 mg

Recombinant Human CDw210a/IL10RA Protein, N-His

Sign In for Pricing
View Details
Neuronal membrane glycoprotein M6 a (GPM6A) (NM_201591) Human 3' UTR Clone
SC217270 10 µg

Neuronal membrane glycoprotein M6 a (GPM6A) (NM_201591) Human 3' UTR Clone

Sign In for Pricing
View Details
MEF2A Polyclonal Antibody, Cy3 Conjugated
bs-1400R-Cy3 100 µL

MEF2A Polyclonal Antibody, Cy3 Conjugated

Sign In for Pricing
View Details
Protein-Glutamine Gamma-Glutamyltransferase 2 (TGM2) Antibody (FITC)
abx107260-01 20 µg

Protein-Glutamine Gamma-Glutamyltransferase 2 (TGM2) Antibody (FITC)

Sign In for Pricing
View Details