Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MAFF cDNA

MAFF is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. Multiple transcript variants encoding two different isoforms have been found for this gene.

Product Specifications

Product Name Alternative

HMafF, U-MAF, Transcription factor MafF

Chromosomal Location

22q13.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCTGTGGATCCCCTATCCAGCAAAGCTCTAAAGATCAAGCGAGAGCTGAGCGAGAACACGCCGCACCTGTCGGACGAGGCGCTGATGGGGCTGTCGGTGCGCGAGCTGAACCGGCATCTGCGCGGGCTCTCCGCCGAGGAGGTGACACGGCTCAAGCAGCGGCGCCGCACACTCAAAAACCGTGGCTACGCCGCCAGCTGCCGCGTGAAGCGCGTGTGCCAGAAGGAGGAGCTGCAGAAGCAGAAGTCGGAGCTGGAGCGCGAGGTGGACAAGCTGGCGCGCGAGAACGCCGCCATGCGCCTGGAGCTCGACGCGCTGCGCGGCAAGTGCGAGGCGCTGCAGGGCTTCGCGCGCTCCGTGGCCGCCGCCCGCGGGCCCGCCACGCTCGTGGCGCCGGCCAGCGTCATCACCATCGTCAAGTCCACCCCGGGCTCGGGGTCTGGCCCCGCCCACGGCCCGGACCCCGCCCACGGCCCGGCCTCCTGCTCCTAG

Additionnal Information

MAFF, hMafF, U-MAF, U MAF, UMAF, Q9ULX9, ATGD0423-10 µg, ATGD0423-20 µg, ATGD0423-50 µg, ATGD0423-100 µg, ATGD0423-250 µg, ATGD0423-500 µg, ATGD0423-1 mg, ATGD0423-010, ATGD0423-020, ATGD0423-050, ATGD0423-100, ATGD0423-250, ATGD0423-500, ATGD0423-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Metabolism

Omim

604877

NCBI Accession Number

NP_001155045.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001161573.1

DNA Size

495bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Escherichia coli O157:H7 Hydrogenase 3 maturation protease (hycI)
orb3155878-01 20 µg

Recombinant Escherichia coli O157:H7 Hydrogenase 3 maturation protease (hycI)

Sign In for Pricing
View Details
Recombinant Escherichia coli O157:H7 Hydrogenase 3 maturation protease (hycI)
orb3155878-02 100 µg

Recombinant Escherichia coli O157:H7 Hydrogenase 3 maturation protease (hycI)

Sign In for Pricing
View Details
Recombinant Escherichia coli O157:H7 Hydrogenase 3 maturation protease (hycI)
orb3155878-03 1 mg

Recombinant Escherichia coli O157:H7 Hydrogenase 3 maturation protease (hycI)

Sign In for Pricing
View Details
ATP1B3 Rabbit Polyclonal Antibody
E10G31144 100 µL

ATP1B3 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Mup13 CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
31156154 3x 1.0 µg DNA

Mup13 CRISPR All-in-one AAV vector set (with saCas9)(Mouse)

Sign In for Pricing
View Details
RNU6-20 sgRNA CRISPR Lentivector (Human) (Target 3)
K1850904 1.0 µg DNA

RNU6-20 sgRNA CRISPR Lentivector (Human) (Target 3)

Sign In for Pricing
View Details