Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

VMAC cDNA

VMAC (vimentin-type intermediate filament associated coiled-coil protein) is a 169 amino acid cytoplasmic protein that colocalizes with vimentin-type intermediate filaments. Abundant in kidney, VMAC is encoded by a gene located on human chromosome 19p13.3.

Product Specifications

Chromosomal Location

19p13.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCGGCGCCGCCGGCCCTGCAGATCCGGGAGGCAAACGCACACCTGGCAGCCGTGCACCGGCGCGCAGCGGAGCTGGAGGCGCGGCTGGACGCGGCGGAGCGCACGGTGCACGCCCAAGCCGAGCGCCTGGCCCTCCACGACCAGCAGCTGCGCGCCGCCCTAGACGAACTGGGTCGCGCCAAGGACCGTGAGATTGCCACACTCCAGGAGCAGCTGATGACCTCAGAAGCCACTGTCCACAGCCTGCAGGCCACCGTGCACCAGAGGGACGAGCTCATTAGGCAGTTGCAGCCCCGGGCTGAGCTGCTGCAGGACATCTGCCGCCGCCGGCCACCCCTGGCTGGGCTGCTGGATGCCCTGGCTGAGGCTGAGCGCCTGGGGCCCCTGCCGGCCAGTGACCCCGGCCACCCACCCCCCGGTGGGCCTGGTCCACCCCTTGACAACAGCACTGGGGAAGAGGCGGACAGGGACCACCTCCAGCCTGCAGTGTTTGGGACCACAGTGTGA

Additionnal Information

VMAC, VMAC, ATGD0399-10 µg, ATGD0399-20 µg, ATGD0399-50 µg, ATGD0399-100 µg, ATGD0399-250 µg, ATGD0399-500 µg, ATGD0399-1 mg, ATGD0399-10, ATGD0399-20, ATGD0399-50, ATGD0399-100, ATGD0399-250, ATGD0399-500, ATGD0399-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

NCBI Accession Number

NP_001017921.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001017921.3

DNA Size

510bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Pus10 (NM_028956) Mouse Tagged ORF Clone
MG208455 10 µg

Pus10 (NM_028956) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
OR6K4P Protein Vector (Human) (pPM-C-HA)
PV108292 500 ng

OR6K4P Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
HiCrome® Acinetobacter Agar Base
M1938-500G 500 g

HiCrome® Acinetobacter Agar Base

Sign In for Pricing
View Details
ZSWIM2 Protein Vector (Human) (pPB-C-His)
PV048429 500 ng

ZSWIM2 Protein Vector (Human) (pPB-C-His)

Sign In for Pricing
View Details
SCF (KITLG) Antibody (C-term) [APR04028G]
APR04028G-01 50 µL

SCF (KITLG) Antibody (C-term) [APR04028G]

Sign In for Pricing
View Details
SCF (KITLG) Antibody (C-term) [APR04028G]
APR04028G-02 100 µL

SCF (KITLG) Antibody (C-term) [APR04028G]

Sign In for Pricing
View Details