Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPL11 cDNA

RPL11 is a ribosomal protein that is a component of the 60S subunit and belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. RPL11 probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for RPL11.

Product Specifications

Product Name Alternative

DBA7, GIG34, L11

Chromosomal Location

1p36.1-p35

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCATCCGCAAACTCTGTCTCAACATCTGTGTTGGGGAGAGTGGAGACAGACTGACGCGAGCAGCCAAGGTGTTGGAGCAGCTCACAGGGCAGACCCCTGTGTTTTCCAAAGCTAGATACACTGTCAGATCCTTTGGCATCCGGAGAAATGAAAAGATTGCTGTCCACTGCACAGTTCGAGGGGCCAAGGCAGAAGAAATCTTGGAGAAGGGTCTAAAGGTGCGGGAGTATGAGTTAAGAAAAAACAACTTCTCAGATACTGGAAACTTTGGTTTTGGGATCCAGGAACACATCGATCTGGGTATCAAATATGACCCAAGCATTGGTATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGGTTTCAGCATCGCAGACAAGAAGCGCAGGACAGGCTGCATTGGGGCCAAACACAGAATCAGCAAAGAGGAGGCCATGCGCTGGTTCCAGCAGAAGTATGATGGGATCATCCTTCCTGGCAAATAA

Additionnal Information

RPL11, DBA7, GIG34, L11, RPL11, ATGD0394-10 µg, ATGD0394-20 µg, ATGD0394-50 µg, ATGD0394-100 µg, ATGD0394-250 µg, ATGD0394-500 µg, ATGD0394-1 mg, ATGD0394-10, ATGD0394-20, ATGD0394-50, ATGD0394-100, ATGD0394-250, ATGD0394-500, ATGD0394-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

604175

NCBI Accession Number

NP_000966.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_000975.3

DNA Size

537bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

HIRA Recombinant Antibody, Cy7 Conjugated
bsm-62304R-Cy7-01 20 µL

HIRA Recombinant Antibody, Cy7 Conjugated

Sign In for Pricing
View Details
HIRA Recombinant Antibody, Cy7 Conjugated
bsm-62304R-Cy7-02 100 µL

HIRA Recombinant Antibody, Cy7 Conjugated

Sign In for Pricing
View Details
Cytochrome P450 11B1/2 Antibody
E035212 100 µg -100 µL

Cytochrome P450 11B1/2 Antibody

Sign In for Pricing
View Details
TLR6 Antibody
253579 0.1 mg

TLR6 Antibody

Sign In for Pricing
View Details
Tert-Butyl (S) -3-hydroxypent-4-enoate
OR1065142-01 250 mg

Tert-Butyl (S) -3-hydroxypent-4-enoate

Sign In for Pricing
View Details
Tert-Butyl (S) -3-hydroxypent-4-enoate
OR1065142-02 1 g

Tert-Butyl (S) -3-hydroxypent-4-enoate

Sign In for Pricing
View Details