Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HN1L cDNA

Hematological and neurological expressed 1-like, also known as HN1L, is proposed to be involved in embryo development. HN1L is expressed in a variety of tissues such as liver, kidney, prostate, testis and uterus at varying levels.

Product Specifications

Product Name Alternative

C16orf34, L11

Chromosomal Location

16p13.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTTCCAGGTCCCGGATAGCGAGGGCGGCCGCGCCGGCTCCAGGGCCATGAAGCCCCCAGGAGGAGAATCGAGCAATCTTTTTGGAAGTCCAGAAGAAGCTACTCCTTCCAGCAGGCCTAATAGGATGGCATCTAATATTTTTGGACCAACAGAAGAACCTCAGAACATACCCAAGAGGACAAATCCCCCAGGGGGTAAAGGAAGTGGTATCTTTGACGAATCAACCCCCGTGCAGACTCGACAGCACCTGAACCCACCTGGAGGGAAGACCAGCGACATTTTTGGGTCTCCGGTCACTGCCACTTCACGCTTGGCACACCCAAACAAACCCAAGGATCATGTTTTCTTATGTGAAGGAGAAGAACCAAAATCGGATCTTAAAGCTGCAAGGAGCATCCCGGCTGGAGCAGAGCCAGGTGAGAAAGGCAGCGCCAGAAAAGCAGGCCCCGCCAAGGAGCAGGAGCCCATGCCCACAGTCGACAGCCATGAGCCCCGGCTGGGGCCGCGGCCTCGCTCTCACAACAAGGTCCTGAACCCACCGGGAGGCAAATCCAGCATCTCCTTCTACTAA

Additionnal Information

HN1L, C16orf34, L11, HN1L, ATGD0379-10 µg, ATGD0379-20 µg, ATGD0379-50 µg, ATGD0379-100 µg, ATGD0379-250 µg, ATGD0379-500 µg, ATGD0379-1 mg, ATGD0379-10, ATGD0379-20, ATGD0379-50, ATGD0379-100, ATGD0379-250, ATGD0379-500, ATGD0379-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Other

NCBI Accession Number

NP_653171.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_144570.2

DNA Size

573bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

C1orf211 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
14186111 3x 1.0 µg

C1orf211 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Nme2-set siRNA/shRNA/RNAi Lentivector (Mouse)
31944094 4x 500 ng

Nme2-set siRNA/shRNA/RNAi Lentivector (Mouse)

Sign In for Pricing
View Details
Anti-MNX1 Antibody
A1635-100 100 µL

Anti-MNX1 Antibody

Sign In for Pricing
View Details
Recombinant Human NOS2/INOS Protein (Trx Tag)
PDEH100624-01 20 µg

Recombinant Human NOS2/INOS Protein (Trx Tag)

Sign In for Pricing
View Details
Recombinant Human NOS2/INOS Protein (Trx Tag)
PDEH100624-02 100 µg

Recombinant Human NOS2/INOS Protein (Trx Tag)

Sign In for Pricing
View Details
Recombinant Human NOS2/INOS Protein (Trx Tag)
PDEH100624-03 500 µg

Recombinant Human NOS2/INOS Protein (Trx Tag)

Sign In for Pricing
View Details