Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

PCOTH cDNA

PCOTH (Prostate collagen triple helix protein) is a 107 amino acid cytoplasmic protein that is specifically expressed in prostate and testis. PCOTH may play a significant role in the proliferation and viability of prostate cancers by way of phosphorylating the oncoprotein I2PP2A.

Product Specifications

Product Name Alternative

C1QTNF9B-AS1

Chromosomal Location

13q12

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTGGATCTTATCAAATTTAATGGGCACATCTGAAGAAGGAAACTTGCTCAGCACCGTGAGCCCCACAGTGAAAGCACTTTTTGGCAAGACTAGAGTCTCACCGATTTTCCCTTTCTCTCCTCGATCTCCTTTCCAGCCTCTTATTCCCCGGACTCCTGGCTCACCCTGGGGCCCCGTGGGTCCAGCTTCTCCCTTGGGACCAGGCTTTCCAATAGGGCCCATGGGGCCCGGTAAACCAGTTGGGCCCAAAGGCCCAATGTTGCCCCTTGGCCCCTCAGGACCAGTGGGACCCACGTCACCCTTATTCCCCTTCTGCCCCTGA

Additionnal Information

PCOTH, C1QTNF9B-AS1 , PCOTH, ATGD0374-10 µg, ATGD0374-20 µg, ATGD0374-50 µg, ATGD0374-100 µg, ATGD0374-250 µg, ATGD0374-500 µg, ATGD0374-1 mg, ATGD0374-10, ATGD0374-20, ATGD0374-50, ATGD0374-100, ATGD0374-250, ATGD0374-500, ATGD0374-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cancer

NCBI Accession Number

NP_001014442.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001014442.2

DNA Size

324bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

HLTF Antibody, mAb, Rabbit
A04420-100 100 µL

HLTF Antibody, mAb, Rabbit

Sign In for Pricing
View Details
GALNT4 antibody - C-terminal region (ARP45528_P050)
ARP45528_P050 100 µL

GALNT4 antibody - C-terminal region (ARP45528_P050)

Sign In for Pricing
View Details
Mouse Pcsk6 activation kit by CRISPRa
GA203129 1 Kit

Mouse Pcsk6 activation kit by CRISPRa

Sign In for Pricing
View Details
Rabbit Anti-Human MBTPS1 pAb
PA9933-01 50 μL

Rabbit Anti-Human MBTPS1 pAb

Sign In for Pricing
View Details
Rabbit Anti-Human MBTPS1 pAb
PA9933-02 100 μL

Rabbit Anti-Human MBTPS1 pAb

Sign In for Pricing
View Details
PARP3 Rabbit Polyclonal Antibody (Carrier-free)
orb3107148 100 µg

PARP3 Rabbit Polyclonal Antibody (Carrier-free)

Sign In for Pricing
View Details